Snap-frozen whole hearts were homogenised in liquid nitrogen before resuspending in TRIZOL Reagent (Invitrogen, Paisley, Paisley, UK) and processed according to the manufacturer’s protocol. DNAse1 treatment was performed using RNAse-free DNAse 1 (Promega) after which phenol–chloroform extraction and ethanol precipitation was performed. RNA was quantified (NanoDrop 1000 spectrophotometer, Thermo Fisher Scientific, Paisley, UK) and cDNA synthesis (20–50 μl reaction) was carried out using RNA Superscript II Reverse Transcriptase (Invitrogen). Real-time quantitative reverse transcriptase PCR (qRT-PCR) was carried out on the Opticon 2 DNA engine thermal cycler (BioRad, UK) using SYBR chemistry (SYBR Green master mix (Qiagen, Manchester, UK)). Reactions were carried out using 1–2 μl of cDNA and unique primers for each gene. GAPDH housekeeping genes were used to correct for variability between samples and relative mRNA levels were calculated using ΔΔCT method (25). Mean±S.D. of >3 independent samples were used for statistical analysis using appropriate packages including Student's t-test (significance P <0.05).
Rnase free dnase 1
Manufactured by Promega
Sourced in United States, China, United Kingdom, Germany
RNase-free DNase I is an enzyme used to degrade DNA in RNA samples. It is designed to minimize RNA degradation during the DNA removal process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (101 mentions)
Rneasy mini kit, by Qiagen (42 mentions)
Trizol, by Thermo Fisher Scientific (40 mentions)
Biotin rna labeling mix, by Roche (26 mentions)
T7 rna polymerase, by Promega (23 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (18 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (14 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (13 mentions)
T7 rna polymerase, by Roche (11 mentions)
Primescript rt reagent kit, by Takara Bio (10 mentions)
M mlv reverse transcriptase, by Promega (10 mentions)
Rneasy plant mini kit, by Qiagen (10 mentions)
Sybr premix ex taq 2, by Takara Bio (8 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (8 mentions)
Streptavidin agarose bead, by Thermo Fisher Scientific (7 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (7 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (6 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (6 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (6 mentions)
Rnaiso plus reagent, by Takara Bio (6 mentions)
339 protocols using rnase free dnase 1
1
Cardiac Gene Expression Quantification
2
RNA Extraction and cDNA Synthesis from Mouse Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was prepared from E12.5 wild type, heterozygous and mutant embryos using Tri reagent (Sigma). RNA (5 μg) was treated with RNase-free DNase 1 (Promega) and cDNA generated using random primers (Promega) and Bioscript reverse transcriptase (Bioline). Primers for Myh10 qPCR are listed in S1 Table .
3
Quantifying Gene Expression in Cardiac Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from whole hearts, NRVM or H9c2 cells using TRIZOL Reagent (Invitrogen). Snap-frozen whole hearts were homogenised in liquid nitrogen before resuspending in Trizol whereas NRVM and H9c2 cells were harvested in Trizol and processed according to the manufacturer's protocol. DNAse1 treatment was performed using RNAse-free DNAse 1 (Promega, Southampton, UK). cDNA synthesis (20–50 μl reaction) was carried out using RNA Superscript II Reverse Transcriptase (Invitrogen). Real-time qRT-PCR was carried out using 1–2 μl of cDNA. ABI Taqman probes or unique primers (for SYBR Green) were used to quantify each gene and reactions were performed using the Opticon 2 DNA engine thermal cycler (Bio-Rad, Hemel Hempstead, UK). Beta-2 microglobulin or GAPDH housekeeping genes were used to correct for variability between samples. Relative mRNA levels were normalised to GAPDH mRNA and calculated using ΔΔCT method. Mean±S.D. of >5 independent experiments were used for statistical analysis using appropriate packages including Student's t-test or Mann-Whitney U-test and significance was shown when P<0.05.
4
Biotin-labeled RNA Affinity Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Biotin‐labelled RNAs were synthesized using Biotin RNA labelling Mix (Roche) and T7 RNA polymerase (Promega), treated with RNase‐free DNase I (Promega) and purified with RNeasy Mini Kit (Qiangen). Next, 3 μg of biotin‐labelled RNAs was mixed with RNA structure buffer (10 mmol/L Tris, pH 7.0, 0.1 mol/L KCl and 10 mmol/L MgCl2) for 20 minutes at room temperature. Then, 107 cells were lysed with 2 mL nuclear separation buffer and 6 mL H2O on ice for 20 minutes. After being centrifuged, the nuclear fraction was resuspended with 1 mL RIP buffer and homogenized 20 minutes. Streptavidin‐agarose beads (Sigma) were incubated with the supernatant for 1 hour and incubated with 5× loading buffer at 95°C for 5 minutes. The specificity of the RNA pull‐down was assessed using Western blot analysis.
5
RNA Isolation and Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of each sample was extracted using an SV Total RNA Isolation System (Promega Z3100) and treated with Rnase-free Dnase I (Promega). The quality and quantity of 24 RNA samples were analyzed, RNA libraries were constructed and sequenced as described45 (link)46 (link). Raw sequencing data were generated using an Illumina HiSeq 2000 system and have been deposited in the NCBI Short Read Archive.
6
Validating RNA-seq Differential Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to validate the reliability of DEGs obtained from RNA-seq, four DEGs were randomly selected from leaves and roots, respectively, for qRT-PCR analysis. RLI (Ta2776) was used as an internal control. Gene-specific primer pairs were designed using Primer Premier 5.0 software (Premier Biosoft International), and primer information is shown in Table S6 . Total RNA from each tissue was extracted as described above. Two micrograms RNA was reverse-transcribed into cDNA using the iScriptTM advanced cDNA Synthesis Kit (Promega, Madison, WI, USA) following RNase-free DNase I (Promega, Madison, WI, USA) treatment. Standard curve for each gene was prepared with several dilutions of cDNA. The qRT-PCR was carried out using SYBR® Green PCR Master Mix (Roche, CH) in a Rotor-Gene 3000 Real Time system (Qiagen, Hilden, Germany). Quantitative PCR reactions cycling conditions were performed as follows: 95 °C for 5 min, followed by 40 cycles at 95 °C for 15 s, 60 °C for 30 s. The relative expression value of the different genes was calculated using 2−△△Ct method [52 ]. The experiment was performed using three biological replicates.
7
Quantifying Cytokine Expression in Cecal Tonsils
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cecal tonsil using TRIZOL reagent (Invitrogen), and subjected to RNase-free DNase I (Promega) digestion and purification. Two micrograms (μg) of RNA was used to synthesize the first-strand cDNA using the Superscript II First-Strand Synthesis Kit (Invitrogen). Real-time quantitative RT-PCR (RT-qPCR) were used to analyze the expression of IL-1β, IL6 and IL-10 in cecal tonsils. The primer pairs used for amplification of IL-1β, IL6 and IL-10 cDNA were listed in Table 2 . RT-qPCR was performed using SYBR® Green I dye and an ABI PRISM® 7500 sequence detection system. Reactions were set up with the following thermal profile: 95 °C for 2 min, 41 cycles of 95 °C for 15 s and 60 °C for 31 s. Relative expression of mRNA was determined after normalization to GAPDH reference using –ΔΔCt method.
Primers used for relative real-time PCRa
| Gene | Primer sequence (5′ → 3′) b | GenBank accession no. |
|---|---|---|
| GAPDH | F: GGTGGAGGAATGGCTGTCA | NM_204305 |
| R: CCTAGGATACACAGAGGACCAGGTT | ||
| IL-1β | F: ACTGGGCATCAAGGGCTA | HM179638 |
| R: GGTAGA AGATGA AGCGGGTC | ||
| IL-6 | F: TTTATGGAGAAGACCGTGAGG | HM179640 |
| R: TGTGGCAGATTGGTAACAGAG | ||
| IL-10 | F: GCTGTCACCGCTTCTTCACCT | EF554720.1 |
| R: GGCTCACTTCCTCCTCCTCATC |
GAPDH Glyceraldehyde-3-phosphate dehydrogenase, IL-1β Interleukin-1 beta, IL-6 Interleukin-6, IL-10 Interleukin 10
aPrimers designed by Primer Express software (Applied Biosystems, Foster City, CA)
bF Forward, R reverse
8
Quantitative Analysis of Leaf Color Variation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from green and red leaf sectors (green or red) of A. tricolor as described above. Approximately 1 μg RNA was digested using RNase-free DNase I (Promega) at 37°C and then reverse-transcribed to cDNA using a PrimeScript II 1st strand cDNA Synthesis Kit (TaKaRa). The qRT-PCR was conducted in a reaction mixture of cDNA, SYBR Green Master Mix (TaKaRa) and gene-specific primer pair (q-AcCATPO-1F/q-AcCATPO-1R, Table 1 ) with Actin (GenBank accession number: 156972026 , see Table 1 for primers) as an internal control. The qRT-PCR was performed using a qTOWER 2.2 real-time PCR system (Analytik Jena).
9
RNA-seq Analysis of Synechocystis 6803
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Synechocystis 6803 and mutants were cultured in BG11 to an OD730 of 1.0 at 30°C in the light of 30 μE m–2 s–1. Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, United States). DNA was removed with RNase-free DNase I (Promega, Madison, WI, United States). RNA was precipitated with isopropanol and stored in 70% ethanol. Strand-specific RNA-seq libraries were prepared using the Illumina small RNA sample preparation kit. RNA sequencing was carried out using the HiSeq 2500 sequencing instrument (Illumina, San Diego, CA, United States) to generate paired-end reads with a length of 150 bp. Reads were aligned against the Cyanobase2 genome sequence for Synechocystis 6803 using TopHat (Trapnell et al., 2009 (link)). Differential gene expression analysis was performed by using the DESeq package (Anders and Huber, 2010 (link)). Fold changes of >2 or <0.5 with P-value of <0.01 were defined as differentially expressed. Data are means ± SD produced from 3 biological replicates. Raw sequence read data has been deposited in the NCBI SRA with the study identifier SRP258660.
10
Investigating miR-671-5p Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA pull-down assay was performed to explore the interaction between miR-671-5p and circDCL1 or CTNNBIP1 in A172 and LN229 cells. miR-671-5p and miR-NC were biotinylated using the biotin RNA Labeling Mix (Roche, Indianapolis, IN, USA) and transcribed using T7/SP6 RN polymerase (Roche). Then, biotin-labeled miR-671-5p (bio-miR-671-5p) and bio-miR-NC were treated with RNase free DNase I (Promega) and RNeasy Mini kit (Qiagen, Redwood City, CA, USA). Next, M-280 streptavidin magnetic beads were incubated with bio-miR-671-5p or bio-miR-NC at room temperature for 4 h, and then with A172 and LN229 cell lysates. The RNA binding to bio-miR-671-5p or bio-miR-NC was extracted with TRIzol reagent for RT-qPCR.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!