Abi 3730xl sequencer

Five major HLA types, namely, HLA-A, HLA-B, HLA-C, HLA-DRB1, and HLA-DQB1, were tested for patient genotyping. Briefly, 2 ml of human blood samples were collected in EDTA anticoagulant tube and DNA samples were extracted. The resulting genomic DNAs were sent to CapitalBio Technology (Beijing, China) for PCR amplification. The PCR condition used is: heating at 96 °C for 3 min, 35 cycles of denaturation at 96 °C for 25 s, annealing at 62 °C for 45 s, and extension at 72 °C for 45 s, and then a final extension at 72 °C for 5 min. The remaining primers in the PCR products were then digested by incubation with ExoI at 37 °C for 15 min. Afterward, ExoI was inactivated by incubation at 80 °C for 20 min. PCR products were then purified and sequenced using high-resolution ABI 3730XL sequencer (Applied Biosystems, Tampa, CA). Sequencing results were analyzed using ATF genotyping software (Conexio Genomics, Fremantle, Australia).

Genomic DNA was extracted from whole blood using a QIAamp DNA Blood Mini Kit 51106 (QIAGEN, Germany) according to the manufacturer's recommended protocol. The promoter, all 5 exons, exon–intron boundaries, and a region in the distal promoter (the phenobarbital response enhancer module, PBREM) of UGT1A1 were PCR amplified and sequenced, as reported before (Huang et al., 2004 (link)). Similarly, the four known SLCO1B polymorphisms (388A > G and 521T > C within the SLCO1B1 gene, IVS8+2087T > C and g.21074122C > T within the SLCO1B3 gene) were investigated. The PCR products were purified from agarose gel and sequenced via an ABI3730XL sequencer (Applied Biosystems, Foster City, CA, USA).
Selection of SNPs was done based on their association with serum bilirubin levels as well as their prevalence in Asia population (Huang et al., 2005 (link); Kang et al., 2010 (link); Zhang et al., 2012 (link); Dai et al., 2013 (link); Chiddarwar et al., 2017 (link)). Finally, a total of 14 SNPs (10 of UGT1A1 and 4 of SLCO1B) were selected. Analysis of linkage disequilibrium (LD) and haplotype were performed by using SNPStats website (https://www.snpstats.net/start.htm). Strong LD was defined as both |D′| and r² > 0.8.

Total RNA was isolated using TRIzol reagent (Invitrogen), according to the manufacturer’s instructions. Five hundred ng of total RNA from each sample were reverse-transcribed (RT) in a 20 μl reaction, which also contained 1x reaction buffer, 0.5 mM dNTPs, 1x DTT, 2 ng random hexamers and 200 units of Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA). The reaction conditions were 5 min at 65 °C, 10 min at 25 °C, 50 min at 42 °C, and 10 min at 70 °C. The subsequent PCR was performed using 2 μl of the cDNA mixture with specific primers targeting the region of interest (Table S9). RT-PCR products were separated by electrophoresis on a 1.5–3.0% agarose gel containing ethidium bromide and visualized by exposure to UV light and sequenced on an ABI 3730xl sequencer (Applied Biosystems, Foster City, CA) using Big Dye Terminator v3.1 cycle sequencing reaction kit (Applied Biosystems).

HIV-1 RNA extraction, cDNA synthesis, and SGA were performed as previously reported^{50 (link)}. For SGA, according to a Poisson distribution, a positive reaction rate of 30% or lower, or cDNA diluted to ensure fewer than 29 PCRs yielded from a total of 96 independent PCRs thus ensuring that amplicons were derived from a single template. Sequences of the env region were amplified by a nested polymerase chain reaction using Premix Ex Taq version 2.0 (Takara, Japan). PCR products derived from cDNA dilutions yielding less than 30% PCR positivity were sequenced by an ABI 3730XL Sequencer using BigDye terminators (Applied Biosystems, Foster City, California, USA). The chromatogram data were cleaned and assembled using Sequencher v4.9 (Gene Codes, Ann Arbor, Michigan, USA).

Following the isolation of genomic DNA using a standard salting‐out procedure (Miller et al., 1988), the entire HBB gene was polymerase chain reaction (PCR)‐amplified and the nucleotide sequence was determined, using two primer sets encompassing exons 1 and 2 (fragment A: Beta1F 5'‐ GGG CCA AGA GAT ATA TCT TAG‐3', Beta1R 5'‐AATGACATGAACTTAACCATAG‐3') and another set encompassing exon 3 and the 3'UTR (fragment B: Beta2F 5'‐GCA CCA TTC TAA AGA ATA ACA G‐3', Beta2R 5'‐GTT TGA ACT AGC TCT TCA TTT C‐3'). The PCR product was purified using a QIAquick PCR Purification Kit (Qiagen), and it was subjected to sequencing by the chain termination method on an ABI 3730 XL sequencer (Applied Biosystems, Foster City, CA, USA). The nucleotide numbering is based on GenBank accession number U01317. Investigations of the hemoglobin A (HBA) genes were carried out by both DNA sequencing and by screening for common α‐globin gene deletions (‐α^3.7, ‐α^4.2, ‐α^20.5, and ^MED) using a standard Gap‐PCR method (Chong, Boehm, Higgs, & Cutting, 2000).