All siRNAs used in this study were purchased from RiboBio. The scrambled siRNA and Trim21 mRNA was injected into the zygotes as the negative control. We placed zygote-stage embryos in 150 µg/mL hyaluronidase (4272; Sigma) to digest the outer granule cells. The siRNA was centrifuged at 12,000 rpm for 10 min at 4 °C, and stored at 4 °C until use. Then, microinjection was performed using a FemtoJet 4i microinjector (Eppendorf, Hamburg, Germany) and E LIPSE Ti micromanipulators (Nikon, Tokyo, Japan). For injection, a glass capillary Femtotip (Eppendorf) was loaded with 2 μL of RNA mixtures using a Microloader (Eppendorf), and the solution was injected into the cytoplasm in a drop of M2 medium (M7167; Merck). The injection volume was approximately 2–5 pL. The injection conditions consisted of an injection pressure of 250 hPa, compensation pressure of 60 hPa, and injection time of 0.7 s. Immediately after microinjection, embryos were cultured in KSOM medium at 37 °C in 5% CO2.
Femtojet 4i microinjector
Manufactured by Eppendorf
Sourced in Germany
The FemtoJet 4i is a microinjector designed for precise and controlled injection of small volumes into cells or other samples. It features programmable pressure and time settings for accurate and reproducible results. The FemtoJet 4i is a laboratory instrument intended for research applications.
Automatically generated - may contain errors
Lab products found in correlation
Microloader tip, by Eppendorf (2 mentions)
Ksom aa, by Merck Group (2 mentions)
Hyaluronidase, by Merck Group (1 mentions)
Microloader, by Eppendorf (1 mentions)
Femtotip, by Eppendorf (1 mentions)
M2 medium, by Merck Group (1 mentions)
Mircury lna mirna mimic, by Qiagen (1 mentions)
Mmessage mmachine kit, by Thermo Fisher Scientific (1 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (1 mentions)
T7 ribomax express kit, by Promega (1 mentions)
Super piggybac transposase, by System Biosciences (1 mentions)
Borosilicate glass needles, by Sutter Instruments (1 mentions)
Mmessage mmachine sp6 transcription kit, by Thermo Fisher Scientific (1 mentions)
Fastpure cell tissue dna isolation mini kit, by Vazyme (1 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
T7 ribomax express rnai kit, by Promega (1 mentions)
Nepa21 electroporator, by Bulldog Bio (1 mentions)
Megascript t7 high yield transcription kit, by Thermo Fisher Scientific (1 mentions)
Embryomax advanced ksom embryo medium, by Merck Group (1 mentions)
Embryo max electroporation buffer, by Merck Group (1 mentions)
26 protocols using femtojet 4i microinjector
1
siRNA Microinjection for Zygote Modification
2
RNAi-Mediated Silencing of CvBV_28-1 in P. xylostella
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNAi, a 25-bp RNA oligo was designed based on the sequence of CvBV_28-1 and synthesized by Sangon Biotech. The sequence is listed in Supplementary Table 5
3
Zebrafish Developmental Genetics Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Procedures were approved by the University of Vermont Institutional Animal Care and Use Committee Protocol Number: 14-053 and the University of Vermont Institutional Biosafety Committee Protocol Number: 14-024. Embryos were raised under standard conditions and staged as previously described (Kimmel et al., 1995 (link); Westerfield, 2000 ). Strains used include: TL; Tg(Rx3:GFP) to label retinal progenitor cells (Rembold et al., 2006 (link)); Tg(pou4f3:GFP) to label sensory hair cells (Xiao et al., 2005 (link)); Tg(ngn1:GFP) to label sensory neurons (Blader et al., 2003 (link)); and Tg(mnx1:mCherry) to label motor neurons (provided by Christine Beattie, Ohio State University). Fertilized embryos were raised at 28.5 or 25°C and staged as previously described (Kimmel et al., 1995 (link)). In some cases, phenylthiourea was added to the embryo media at a concentration of 0.003% at 24 h post fertilization (hpf) in order to inhibit pigment formation.
Injections were performed at the 1-2 cell stage using an Eppendorf Femtojet 4i microinjector. A translation blocking hars morpholino (ATGGTGCTCCAGAAACACAGCCGAT), p53 morpholino (Robu et al., 2007 ), and GeneTools Standard Control Oligo (GeneTools, Philomath, OR, United States) were injected at the amounts indicated in results. Human HARS and zebrafish ccnd1 mRNA were injected at a dose of 200 pg.
Injections were performed at the 1-2 cell stage using an Eppendorf Femtojet 4i microinjector. A translation blocking hars morpholino (ATGGTGCTCCAGAAACACAGCCGAT), p53 morpholino (Robu et al., 2007 ), and GeneTools Standard Control Oligo (GeneTools, Philomath, OR, United States) were injected at the amounts indicated in results. Human HARS and zebrafish ccnd1 mRNA were injected at a dose of 200 pg.
4
Genetic Manipulation in Zebrafish Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild‐type zebrafish of AB* strain were raised in an automatic circulating system (Genomic‐Design) at 28.5°C and maintained in accordance with guidelines of the Ulsan National Institute of Science and Technology (UNIST) Institutional Animal Care and Use Committee (IACUC) (IACUC approval number: UNISTIACUC‐15‐14). Every MO against cobll1b, pacsin2, sh3bp1, and rac1a (Gene Tools, Philomath, OR, USA) was diluted in diethyl pyrocarbonate (DEPC)‐treated water as a 25 ng/nL stock. Ten nanograms of cobll1b‐MO, 1 ng of pacsin2‐MO, 2.5 ng of sh3bp1‐MO, and 2.5 ng of rac1a‐MO were injected into wild‐type embryos at the one‐cell stage. The sequences of the splice‐blocking MOs were 5′‐CTTCTCCAATCAGTCGCCCTCAC‐3′ for pacsin2‐MO, 5′‐ATCATTCAAACCTTCACCTTATAGA‐3′ for sh3bp1‐MO, and 5′‐CATCTGTATTAGCTTGTTACCGTCT‐3′ for rac1a‐MO. The cDNA of pacsin2 was synthesized using wild‐type zebrafish embryo RNA and inserted into the PCS2+ vector. Full‐length pacsin2 was synthesized from linearized pCS2+ pacsin2 through in vitro transcription (mMESSAGE mMACHINE Kit, Ambion). Pacsin2 mRNA was injected into wild‐type embryos at the one‐cell stage. Microinjections were performed using a Femtojet 4i microinjector (Eppendorf).
5
RNAi Silencing of Insect Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNAi, 200~500 bp DNA fragments of the target genes were PCR amplified from the relevant plasmids as templates. Forward and reverse primers containing T7 promoter sequences at their 5’ end were used for PCR amplification of the double-stranded RNA (dsRNA) templates (S1 Table ). dsRNA was synthesized using a T7 RiboMAX Express Kit (Promega) according to the manufacturer’s instructions. To avoid off-target effects, two nonoverlapping dsRNAs were synthesized for PxTK. The length of the PxTK open reading frame (ORF) is 891 bp, the first dsRNA that we designed for PxTK silencing is from the 85 bp position to the 600 bp position on the PxTK ORF (dsPxTK), and the second dsRNA for PxTK silencing is from the 604 position to the 877 bp position (dsPxTK604-877). However, one dsRNA was synthesized for PxTKR silencing in this study (dsPxTKR). A 328-bp coding sequence from green fluorescent protein (GFP) was used as a control dsRNA (dsGFP). The dsRNA was quantified using a NanoDrop 2000 spectrophotometer (Thermo Scientific). A total of 1 μg dsRNA was injected into each P. xylostella larva using the Eppendorf FemtoJet 4i Microinjector with the following parameters: injection pressure = 900 hPa; injection time = 0.15 sec. At least three biological replicates were performed.
6
Organoid Microinjection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A glass capillary of 1mm diameter (WPI) was pulled by micropipette puller (Shutter Instrument) and the tip of the capillary was cut by sharp blade (the size of the capillary end is 9-12µm). Then, the capillary was filled with oocyst- or sporozoite- suspension by microloader tip (Eppendorf). The filled capillary was loaded in Femtojet 4i microinjector (Eppendorf) and used for microinjection. Around 100-200nl of suspension was injected into each organoid.
7
In utero Electroporation of Embryonic Brain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In utero electroporation was performed as described previously using the following plasmids: pLKO.1-Cic shRNA (Sigma, TRCN0000304642; 5′-CCGGAGCGGGAGAAGGACCATATTCCTCGAGGAATATGGTCCTTCTCCCGCTTTTTTG-3′), pLKO.1-non-targeting shRNA (Sigma; 5′-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG-3′), pCIG2-Cre (which contains Cre-IRES-GFP), pCIC-ETV5 (which contains Etv5-IRES-mCherry), Super piggyBac Transposase (Systems Biosciences, SBI), and piggyBac cargo vector PB513B-1 (SBI) into which cDNAs were cloned for Turbo-Cre and Etv5. The DNETV5 consists of an Etv5-EnR fusion (gift of Dr. Carol Schuurmans) cloned into the piggyBac construct modified to contain the CAG promoter and GFP-luciferase. DNA was prepared with Endo-free DNA kit (Qiagen) and was injected at 1.5 μg/μl into the telencephalic vesicles of embryos in time-staged pregnant females using a Femtojet 4i microinjector (Eppendorf) then followed by electrical pulses (6 × 43 V, 950 ms interval) applied by platinum tweezer-style electrodes (7 mm, Protech) uSsing a BTX square wave generator (Harvard Apparatus). Post-procedure, embryos were allowed to develop until the time of harvesting. EdU (50 mg/ml in phosphate-buffered saline; PBS) was injected intraperitoneally into the pregnant dam 30 min prior to killing.
8
Zygote Microinjection of CRISPR Tools
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In preparation for zygote microinjection, C57BL/6J female mice at 4 weeks of age were superovulated by intraperitoneal injections of PMSG (5 IU, Prospec) and hCG hormone (5 IU, Sigma-Aldrich) with a 48-h interval between injections. For microinjection, a mixture containing left DdCBE (or DdCBE-NES)-encoding mRNA (300 ng/μl) and right DdCBE (or DdCBE-NES)-encoding mRNA (300 ng/μl) was diluted in DEPC-treated injection buffer (0.25 mM EDTA, 10 mM Tris, pH 7.4) and injected into the cytoplasm of zygotes using a Nikon ECLIPSE Ti micromanipulator and a FemtoJet 4i microinjector (Eppendorf). For co-injection of DdCBE and mitoTALEN, we added left and right mitoTALEN-encoding mRNAs (300 ng/μl each) to the injection buffer. After injection, embryos were cultured in microdrops of KSOM+AA (Millipore) at 37 °C for 4 days in a humidified atmosphere containing 5% CO2. Two-cell stage embryos were implanted into the oviducts of 0.5-dpc pseudo-pregnant foster mothers.
9
Ube2h knockdown and overexpression in zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One-cell stage embryos were injected with 1 nl of antisense ube2h MO (GeneTools, Philomath, OR, USA) and/or ube2h mRNA. ube2h MO-5’-ACTCTCGATGCTAAAGGAAGAATGT-3’ was used at a concentration of 2.5 ng/nl. ube2h mRNA was synthesized from linearized pCS2p+ vectors using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, Waltham, MA, USA) and used at a concentration of 100 pg/nl. A FemtoJet 4i microinjector (Eppendorf, Hamburg, Germany) was used for microinjection with borosilicate glass needles (Sutter Instrument, Novato, CA, USA) fabricated on a PMP-102 Micropipette Puller (MicroData Instrument, Plainfield, NJ, USA).
10
Antimicrobial Activity of CvT-serpins in Insect Larvae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To estimate the antimicrobial activity of CvT-serpins in vivo, 0.1 μl samples of equivalent mixtures of rCvT-serpin (300 ng/μl for rCvT-serpin3 and 100 ng/μl for rCvT-serpin5) with S. aureus (OD600 = 0.1) or E. coli (OD600 = 0.1) were injected into unparasitized early fourth instar P. xylostella larvae by a FemtoJet 4i Microinjector (Eppendorf, Germany) with a microcontroller (Narishige, Japan). An equal dose of PBS or GST protein was used as a blank or negative control, respectively. Injected P. xylostella larvae were then fed normally until 24 h post-injection, the surface of the treated larvae was disinfected with 75% alcohol, and then homogenized after the midgut was removed. This homogenate was then 100 times diluted with sterile PBS before being incubated on LB agar at 37 °C for 24 h, and then the number of CFU was counted. Synchronously, DNA was extracted from the above-treated larvae using FastPure Cell/Tissue DNA Isolation Mini Kit (Vazyme, China) to determine the relative levels of 16S rRNA by qPCR. For the survival rate analysis, pseudoparasitized, unparasitized, or parasitized early fourth instar P. xylostella larvae were injected in the same way as for bacterial load assessment. The injected P. xylostella larvae were reared at 25 °C and provided with fresh food daily, and the death rate was recorded every 12 h.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!