Total RNAs in TSCC cell lines were extracted with RNAsimple Total RNA Kit (DP419, TIANGEN, Beijing, China) and reverse-transcribed into cDNA templates using M-MLV reverse transcriptase (NG212, TIANGEN). The designed specific primer sequences were synthesized by Sangon Biotech (Shanghai, China) and shown as follows (5′–3′): miR-135a-5p, RT GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACTCACAT, forward GCCGTATGGCTTTTTATTCCTA and reverse GGTGCAGGGTCCGAGGTATT; U6, RT GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAAAATATGG, forward GCTTCGGCAGCACATATACT and reverse GGTGCAGGGTCCGAGGTATT; DANCR forward ACCCTCCTGCTTCCCTC and reverse CCCGAAACCCGCTACAT; KLF8 forward TCATTGGAGGAGATGGTAA and reverse GCTGCTGGTTCTTGCTGT; GAPDH forward GACCTGACCTGCCGTCTAG and reverse AGGAGTGGGTGTCGCTGT. Subsequently, the mixture of cDNA templates, specific primers, SYBR Green reagent (SY1020, Solarbio, Beijing, China) and Taq PCR MasterMix (KT201, TIANGEN) were used to amplify target genes by qRT-PCR analysis on Exicycler 96 PCR system (Bioneer, Daejeon, Korea). GAPDH was normalized for DANCR and KLF8 expression, and U6 was normalized for miR-135a-5p expression. Relative expression was calculated using the 2− ΔΔCT method.
Sybr green reagent
Manufactured by Solarbio
Sourced in China
The SYBR Green reagent is a fluorescent dye used for detecting and quantifying DNA in various applications, such as real-time PCR and DNA gel electrophoresis. It binds to double-stranded DNA, emitting a fluorescent signal that can be measured to determine the DNA concentration.
Automatically generated - may contain errors
Lab products found in correlation
Ripa lysis buffer, by Beyotime (3 mentions)
High purity total rna fast extraction kit, by BioTeke (2 mentions)
Super m mlv reverse transcriptase, by BioTeke (2 mentions)
Taq pcr mastermix, by Tiangen Biotech (1 mentions)
Exicycler 96 pcr system, by Bioneer (1 mentions)
M mlv reverse transcriptase, by Tiangen Biotech (1 mentions)
Rnasimple total rna kit, by Tiangen Biotech (1 mentions)
Oligo dt 15, by Sangon (1 mentions)
Exicycler 96 system, by Bioneer (1 mentions)
Beyort 2 m mlv reverse transcriptase, by Beyotime (1 mentions)
M mlv reverse transcriptase, by BioTeke (1 mentions)
Exicycler 96 real time quantitative thermal block, by Bioneer (1 mentions)
Rnapure total rna fast isolation kit, by BioTeke (1 mentions)
10 protocols using sybr green reagent
1
Quantification of miRNA and mRNA in TSCC
2
Eaf2 mRNA Expression Quantification by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the RNA simple Total RNA kit (cat. no. DP419; Tiangen, Beijing, China), according to the manufacturer's instructions. The total RNA was reverse transcribed into cDNA by Moloney mouse leukemia virus reverse transcriptase (BioTeke) and oligo (dT)15 (Sangon Biotech). Eaf2 mRNA levels were determined by RT-qPCR using the SYBR GREEN method with cDNA as template. SYBR GREEN reagent was purchased from Solarbio. The primers used are as follows: Eaf2 forward, 5′-CTTGCATACCTGGACCGT-3′ and reverse, 5′-GTTCACCTTTGCCAACCTCA-3′; β-actin forward, 5′-CTGTGCCCATCTACGAGGGCTAT-3′ and reverse, 5′-TTTGATGTCACGCACGATTTCC-3′. The primers were synthesized by Sangon Biotech. The RT-qPCR reaction volume (20 µl), contained cDNA (1 µl), forward primer (10 µM; 0.5 µl), reverse primer (10 µM; 0.5 µl), SYBR GREEN mastermix (10 µl) and water. An Exicycler™ 96, BIONEER Real-Time PCR system was used (Bioneer Corporation, Daejeon, Korea) and the reaction conditions were as follows: 95°C for 10 min followed by 40 cycles of 95°C for 10 sec, 60°C for 20 sec and 72°C for 30 sec, and final incubation at 4°C 5 min. The relative mRNA expression levels for each sample were calculated using the 2−ΔΔCt method with β-actin as an internal reference (15 (link)).
3
Quantifying ROCK-1 and Rac1 mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with RIPA lysis buffer (Beyotime Institute of Biotechnology). cDNA was then reverse-transcribed according to the methods described in a previous study. The mRNA expression was measured via qRT-PCR (SYBR Green method).39 The SYBR Green reagent was obtained from Solarbio Life Sciences (Beijing, China). The relative mRNA levels were normalized to GAPDH and calculated using the 2−ΔΔCt method as described in a previous study.40 (link) The following primers were used in the present study: ROCK-1 (Forward: 5′-ACCTGTAACCCAAGGAGATGTG-3′, Reverse 5′-CACAATTGGCAGGAAAGTGG-3′), and Rac1 (Forward 5′-ATGCAGGCCATCAAGTGTGTGG-3′, Reverse: 5′-TTACAACAGCAGGCATTTTCTC-3′). The experiments were performed in triplicate and repeated three times with similar results.
4
Quantifying CXCR4 and CXCR7 mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with RIPA lysis buffer (Beyotime Institute of Biotechnology, China). cDNA was then reverse-transcribed according to the methods described in a previous study [33 (link)]. The mRNA expression was measured via qRT-PCR (SYBR Green method). The SYBR Green reagent was obtained from Solarbio (Beijing, China). The relative mRNA levels were normalized to GAPDH and calculated using the 2−ΔΔCt method as described in a previous study. The following primers were used in the present study: CXCR4: 5′-TCAGTGGCTGACCTCCTCTT-3′, reverse 5′-CTTGGCCTTTGACTGTTGGT-3′; CXCR7: 5′-TGGGCTTTGCCGTTCCCTTC-3′ and 5′-TCTTCCGGCTGCTGTGCTTC-3′; and GAPDH: 5′-AGATCATCAGCAATGCCTCC-3′ and 5′-GTGGCAGTGATGGCATGGAC-3′.
5
Cardiac Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from reperfused hearts using RIPA lysis buffer (Beyotime Institute of Biotechnology, China). Subsequently, cDNA was reverse-transcribed according to a previous study. mRNA expression was measured through qRT-PCR (SYBR Green method). The SYBR Green reagent was obtained from Solarbio (Beijing, China). Relative mRNA levels were normalized to GAPDH and calculated using the 2−ΔΔCt method based on the methods of a previous study. The following primers were used in this study: TNFα (forward, 5′-AGATGGAGCAACCTAAGGTC-3′; reverse, 5′GCAGACCTCGCTGTTCTAGC-3′), IL-6 (forward, 5′-CAGACTCGCGCCTCTAAGGAGT3′; reverse, 5′-GATAGCCGATCCGTCGAA-3′), MCP1 (forward, 5′-GGATGGATTGCACAGCCATT-3′; reverse, 5′-GCGCCGACTCAGAGGTGT-3′), GAPDH, (forward: 5′-AAGTTGTGFATTAGTCA-3′, reverse: 5′-AGAATAGTCCTATAATCA-3′), Mfn1 (forward 5′- CATGGACGAGCTGGCCTTC-3′, reverse 5′-ATCCTGTAGTGATGTATCAGG-3′), Mfn2 (forward 5′-CCTCTTGATCCTGATCTTAACGT-3′, reverse 5′-GGACTACCTGATTGTCATTC-3′), and OPA1 (forward 5′-GCTACTTGTGAGGTCGATTC-3′, reverse 5′-GCCGTATACCGTGGTATGTCTG-3′).
6
FMNL2 mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA in cells from each group was extracted using a High-purity Total RNA Fast Extraction kit (BioTeke, Beijing, China) and reverse transcribed to cDNA using Oligo(dT)15 and Super M-MLV Reverse Transcriptase (BioTeke) according to the manufacturers’ instructions. mRNA level of FMNL2 in each group was measured by qRT-PCR (SYBR Green method) with cDNA as the template. The following primers were used: forward primer for FMNL2, 5′-CCCGCTCTGGAAGACATT-3′; reverse primer for FMNL2, 5′-CTGCCAACAGTTCTAAGACAAG-3′; forward primer for β-actin, 5′-CTTAGTTGCGTTACACCCTTTCTTG-3′; reverse primer for β-actin, 5′-CTGTCACCTTCACCGTTCCAGTTT-3′. SYBR Green Reagent was obtained from Solarbio (Beijing, China). The relative mRNA level of FMNL2 was normalized to β-actin and calculated using 2−ΔΔCt method.
7
Gene Expression Analysis of Colon Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the ground colon tissues in nitrogen and cultured cells was extracted using the TRIpure Reagent lysis buffer (RP1001, BioTeke, China), followed by cDNAs reverse transcription with the BeyoRT II M-MLV reverse transcriptase (D7160L, Beyotime). qPCR was performed with the SYBR Green reagent (SY1020, Solarbio) on the Exicycler 96 system (Bioneer, Korea). The primer sequences (5’-3’) were shown: Nfatc3 forward GGTAAAGAGCAGCACATA, Nfatc3 reverse TTGACTAGAGGCAGGATT; MCP-1 forward GCCTGCTGTTCACAGTTGCC, MCP-1 reverse CTGGACCCATTCCTTCTTGG; TNF-α forward CAGGCGGTGCCTATGTCTCA, TNF-α reverse GCTCCTCCACTTGGTGGTTT; IL-6 forward ATGGCAATTCTGATTGTATG, IL-6 reverse GACTCTGGCTTTGTCTTTCT; IL-1β forward CTCAACTGTGAAATGCCACC, IL-1β reverse GAGTGATACTGCCTGCCTGA; Pou3f1 forward CGTGTTCTCGCAGACCACCATC, Pou3f1 reverse CGCACCACCTCCTTCTCCAGTT; GAPDH forward TGTTCCTACCCCCAATGTGTCCGTC, GAPDH reverse CTGGTCCTCAGTGTAGCCCAAGATG. The relative gene expression was calculated with the 2−ΔΔCt method and normalized to GAPDH.
8
Gene Expression Analysis of Mouse Skin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNAs from mouse skin tissues were isolated and reverse-transcribed into cDNA templates. To amplify the target genes, the specific primers (5′–3′) were designed as follows: TNF-α (forward CAGGCGGTGCCTATGTCTCA and reverse GCTCCTCCACTTGGTGGTTT), IL-6 (forward ATGGCAATTCTGATTGTATG and reverse GACTCTGGCTTTGTCTTTCT), IL-1β (forward CTCAACTGTGAAATGCCACC and reverse GAGTGATACTGCCTGCCTGA), IL-17A (forward AAACACTGAGGCCAAGGAC and reverse CGTGGAACGGTTGAGGTAG), IL-22 (forward GACAGGTTCCAGCCCTACAT and reverse CAGCCTTCTGACATTCTTCT), and GAPDH (forward TGTTCCTACCCCCAATGTGTCCGTC and reverse CTGGTCCTCAGTGTAGCCCAAGATG). The analysis of quantitative real-time PCR (qPCR) was performed using SYBR Green reagent (SY1020, Solarbio). Finally, 2−ΔΔCT method was used to calculate relative gene expression.
9
Quantification of AQP4 mRNA in Brain Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA in brain tissues was extracted using the High-purity Total RNA Fast Extraction Kit (BioTeke, Beijing, China) according to the manufacturer’s instructions. Then, the RNA was reversely transcribed to cDNA with oligo(dT)15 and M-MLV reverse transcriptase (BioTeke) according to the protocol. The mRNA levels of AQP4 were determined using qRT-PCR on an Exicycler™ 96 real-time quantitative thermal block (BIONEER, Daejeon, Korea). The following primers were used: AQP4 forward primer: 5′-ATCGCCAAGTCCGTCTTCTACATC-3′; AQP4 reverse primer: 5′-AACCGTGGTGACTCCCAATCC-3′; β-actin forward primer: 5′-GGAGATTACTGCCCTGGCTCCTAGC-3′; β-actin reverse primer: 5′-GGCCGGACTCATCGTACTCCTGCTT-3′. The SYBR Green reagent was obtained from Solarbio. The mRNA level of AQP4 was normalized to β-actin and calculated using 2−ΔΔCt method.
10
Quantifying miR-146a and IRAK1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted by a RNApure total RNA fast isolation kit (BioTeke, China). Then the total RNAs were reversely transcribed to cDNAs by a Super M-MLV Reverse Transcriptase (BioTeke). RNA expression was detected by quantitative real-time PCR in Real-Time Quantitative Thermal Block (BIONEER, Korea) using the SYBR-Green reagent (Solarbio, China). For the miR-146a expression, U6 was used as an internal control. β-actin was used as an internal reference gene for IRAK1. The primer sequence information was listed in Table 1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!