Total RNA was extracted from the plant leaves of Cucurbitaceae using TRIzol. RNA quantity was determined on a NanoDrop 2000 Spectrophotometer (Thermo Scientific, San Jose, California, USA). RNA integrity was analyzed by electrophoresis on 1.5% agarose gels and the purity and concentration assessed. RNA (1 μg) from each sample was reverse transcribed in a final volume of 20 μL using the Takara 3′-Full RACE Core Set with the PrimeScript™ RTase synthesis kit.
3 full race core set
Manufactured by Takara Bio
Sourced in Japan, China
The 3'-Full RACE Core Set is a laboratory equipment product designed for rapid amplification of cDNA ends (RACE) analysis. It provides the essential components required to perform 3'-Full RACE experiments, which are used to determine the complete 3' end sequence of RNA transcripts.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rtase, by Takara Bio (10 mentions)
5 full race core set, by Takara Bio (6 mentions)
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
5 full race kit with tap, by Takara Bio (5 mentions)
Primescript rtase kit, by Takara Bio (4 mentions)
5 full race kit, by Takara Bio (4 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Firstchoice rlm race kit, by Thermo Fisher Scientific (2 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (2 mentions)
Cfx96 real time system, by Bio-Rad (2 mentions)
Smarter race 5 3 kit, by Takara Bio (2 mentions)
Peasy t3, by Transgene (2 mentions)
Miseq reagent kit v2, by Illumina (2 mentions)
Nebnext ultra rna library prep kit for version 2, by Illumina (2 mentions)
Trizol ls reagent, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Pgem t vector, by Promega (2 mentions)
Recombinant rnase free dnase, by Takara Bio (1 mentions)
Reverse transcription system, by Promega (1 mentions)
Ex taq, by Takara Bio (1 mentions)
45 protocols using 3 full race core set
1
Total RNA Extraction and cDNA Synthesis
2
Transcriptome Analysis of Soybean Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The soybean tissues, including anthers, pistils, petals and sepals from the early, middle and late stages of buds, as well as flowers, leaves and culms, were harvested for RNA isolation by using RNA extraction and purification kits (GBTbiotech, Beijing, China), and the RT reaction was performed using an RT system (GenStar, China) following the manufacturer's protocol. Additionally, RT‐qPCR was performed using GenStar Green Fast Mixture with ROX II (GenStar, China) according to the manufacturer's instructions on the ABI Prism 7500 Software (ABI, USA) in triplicate. The amplification of ACTIN was used as the internal control. Three replicates were performed for each experiment, the data was analyzed by the (2‐ΔΔCT (DDCT)) method, and quantitative results were given as means ± SD (Livak and Schmittgen, 2001 (link)). 3′‐RACE was performed using a 3′‐Full RACE Core Set (Takara, Japan) following the manufacturer's instructions.
3
Cloning the amphioxus Bjamp1 gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Based on analyses above, we tried to clone the homologue of BW801384.1, hereafter named as Bjamp1, from Qingdao amphioxus B. japonicum. Total RNAs were extracted from B. japonicum with Trizol (Invitrogen) according to the manufacturer’s instructions. After digestion with recombinant RNase-free DNase (TaKaRa) to eliminate the genomic contamination, the first-strand cDNA was synthesized with reverse transcription system (Promega) using oligo d(T) primer, and used as PCR template. The fragment of Bjamp1 was amplified by PCR with the primer pairs P1-F and P1-R (Table 3 ) that were designed using Primer Premier 5.0 program on the basis of relative sequences identified in B. floridae genome database (http://genome.jgi-psf.org/Brafl1/Brafl1.home.html ) and in B. belcheri genome database (http://mosas.sysu.edu.cn/genome/index.php ). After determination of the partial cDNA sequence, rapid amplification of cDNA ends (RACE) was employed to obtain the full-length cDNA. The gene-specific primer pairs P2-F and P3-F (Table 3 ) were used in RACE reactions for the cloning of 3’-end cDNAs. The 3’-RACE-Ready cDNAs were synthesized from the total RNAs using the 3’ Full RACE Core Set (TaKaRa, Dalian, China) according to the manufacturer’s instructions. The products of 3’-RACE were gel-purified, sub-cloned and sequenced, and Bjamp1 cDNA was obtained by assembling the overlapping sequences.
4
Full-length Sequencing of linc-RA1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from M059K cells as described above. 5′-RACE was performed using a 5′-Full RACE Kit with TAP (Takara); 3′-RACE was performed using a 3′-Full RACE Core Set with PrimeScript RTase Kit (Takara) following the manufacturer’s instructions. The full-length sequence of linc-RA1 is listed in Supplementary Table 1 .
5
cDNA Synthesis and Nested PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First-strand synthesis of cDNA was performed using the 3´-Full Race Core Set (Takara Bio Inc.), in accordance with the manufacturer’s instructions. A 2 μl aliquot of the resulting cDNA was mixed with 33.6 μl of sterile, distilled H2O, 5.0 μl of 10 X buffer, 5.0 μl of dNTP (2.5 mM each), 2.0 μl of each primer (5 μM), and 0.4 μl of 0.25 units of EX Taq (Takara Bio Inc.), for a 50-μl total reaction volume. L1384-COI and 3sites Adaptor Primer (3´-Full Race Core Set; Takara Bio Inc.) pairs were used. Thermal cycle parameters were the same as stated above for nested PCR, with the sole exception of the extension time, which was increased to 120 seconds. Thirty cycles were performed. Since clear single bands were not observed in PCR products from N. cristatus and N. plumchrus, a second round of amplification was carried out in each case, using 1.0 μl of the previous PCR product as a template. L1545-COI (5′-GCT CAT GCW TTT GTC ATG ATT TTT TTT ATG G-3′ [11 ]) and 3sites Adapter Primer (3´-Full Race Core Set; Takara Bio Inc.) pairs were used in this step. The PCR procedure was the same as that of the first round of amplification.
6
MORC2 cDNA Amplification via 3'RACE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
3′Full Race Core Set (Takara) was used to generate MORC2 cDNA. MORC2 GSP-1 primers and 3′RACE outer primers were used to perform the first-round PCR. MORC2 GSP-2 primers and 3′RACE inner primers were used to perform the nested PCR. The PCR products were cloned with TA/Blunt-Zero kit (Vazyme) and further sequenced. The primers are listed in Supplemental Table 1 .
7
Cloning and Sequencing of β-Mannanase Gene from T. trachyspermus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from T. trachyspermus grown in MM at 25 °C for 6 days at 150 rpm and purified using the RNeasy Mini kit (QIAGEN, Hilden, Germany), according to the manufacturer’s instructions. The first-strand cDNA from the total RNA was synthesized using the ReverTra Dash kit (Toyobo Co., Ltd., Osaka, Japan). A partial cDNA fragment of the T. trachyspermus β-mannanase gene was amplified by polymerase chain reaction (PCR) using degenerated primers (forward; 5′-GAYACNTTYCCNGGNACNAAY-3′ and reverse; 5′-TTNRCNAGYTCCCANGCRAA-3′) designed on the basis of the N-terminal amino acid sequence of the mature TtMan5A and highly conserved amino acid sequences in GH5 β-mannanases; the CODEHOP program was employed.24) (link) The amplified DNA fragment was subcloned into the pGEM-T Easy vector (Promega Corporation, Madison, WI, USA) and sequenced using the ABI PRISM 310 genetic analyzer (Life Technologies Co., Carlsbad, CA,USA). To obtain the full-length sequences of the β-mannanase gene, 5′ and 3′ rapid amplification of cDNA ends (RACE) was performed using the FirstChoice RLM-RACE Kit (Ambion, Austin, TX, USA) and the 3′-Full RACE Core Set (Takara Bio, Inc.) in accordance with the manufacturers’ instructions.
8
Identification of DIT1 3'-UTR sequence
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rapid amplification of cDNA ends PCR (RACE-PCR) was used to identify the complete sequence of the DIT1 3′-UTR (3′-Full RACE Core set; Takara Bio Inc., Shiga, Japan). One microgram of total RNA isolated from the DIT1t strain was reverse-transcribed by using the oligo(dT) adaptor primer, and this first-strand cDNA was amplified with PrimeSTAR HS DNA polymerase (Takara Bio Inc.) by using an optimized GFP-specific primer (5′-CCAGACAACCATTATTTG-3′) and an anchor primer. Amplified 3′-RACE products were cloned into the pCR4Blunt-TOPO vector (Invitrogen); more than 20 independent clones were sequenced.
9
cDNA Synthesis and Coding Sequence Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesized from 5 μg of RNA using 3′-Full RACE Core Set (Takara Bio) according to the manufacturer’s protocol. As the reverse transcription primer, ‘Oligo dT-3 sites Adapter Primer’ attached to the product was used. Coding sequence linked to mKGC was amplified using KOD FX neo polymerase (TOYOBO) (Tables 1 and 2 ). The PCR primer sequence is shown in Table 3 .
10
Rapid Amplification of cDNA Ends
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5′ and 3′ RACE were performed using 5′-Full RACE Core Set (TaKaRa) and 3′-Full RACE Core Set (TaKaRa) according to the manufacturer’s protocols. The primers used in 5′ RACE were 5′ end-phosphorylated RT Primer: P-GGACTGAATTCGTG, 1st PCR primers: S1:GTTTAATTGATAATTGTTCTG and A1:CGAGTGTACTGATCTGAT, 2nd PCR primers: S2:ATTATGCCGGCTCCTGCCAG and A2:CGATAGGTGTTCGTGGTTAC. Primers used in 3′ RACE were Reverse transcription primer; oligo(dT)-containing Adapter Primer: GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT, 1st PCR primers: Gene-Specific Primer 1 (GSP 1): TTTTTCTATCAGTTTTCTTTGAGCTTTTAC, Abridged Universal Amplification Primer 1(AUAP 1): GGCCACGCGTCGACTAGTAC, 2nd PCR primers: GSP2: GAGGGTACGGTGGTTTGATGACACTGAAC, AUAP2: GGCCACGCGTCGACTAG, and 3rd PCR primers: AUAP2 and GSP3: GCACCAAAGAGACAGAACCTGTAATTTTAAAAACTGTG.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!