Colorless gotaq flexi buffer

According to the manufacturer’s instructions, DNA was extracted directly from Sterivex filters using the Qiagen Blood & Tissue DNA Purification Kit with slight modifications (Supplementary Data S1). The DNA quantity and quality of the obtained DNA isolates were measured with the Colibri Microvolume Spectrometer device.
The 16S rDNA genes of hypervariable regions 16S V3 and V4 were amplified using the following specific primers: 16sV3F [24 (link)] (ACTCCTACGGGAGGCAGCAGT) and 16sV3R [25 (link)] (ACCGCGGCTGCTGGCAC), 515F-Y [26 (link)] (GTGYCAGCMGCCGCGGTAA) and 806R-B [27 (link)] (GGACTACNVGGGTWTCTAAT). PCR was performed with a primary heating step for 2 min at 94 °C, followed by 30 cycles of denaturation for 1 min at 94 °C, annealing for 45 s at 53 °C, and extension for 1 min at 72 °C, then followed by a final extension step for 5 min at 72 °C. Each 10 μL reaction mixture contained 2 μL of 5× Promega Colorless GoTaq Flexi buffer, 1:10 and 1:100 diluted 0.5 μL DNA, 1 μL of 25 mM MgCl₂, 0.8 μL of 3.2 μM dNTP, 0.5 μL of each primer (5 pmol/mL), 0.1 μL of Taq DNA polymerase, and sterile water to a final volume of 10 μL. For each field and primer, DNA concentration was optimized with serial dilutions as 1:10 and 1:100. For the dilution, distilled water was used. PCR-amplified products were examined by electrophoresis using a 2% agarose gel.

To verify the results from the HIS1 KASP assay, the HIS1 gene from three randomly selected weedy rice samples from each class (homozygous tolerant, sensitive, and heterozygous) plus LaKast and Purple Marker were sequenced. The primers used to amplify a 300 bp amplicon centered around the SNPs of interest were the forward primer 5′ATGGCAAGAACTTCCAGATTC 3′ and the reverse primer 5′AGACAACAATCCTTGTTACTTTGTAAG 3′. Each 50 µL PCR reaction consisted of 1× Colorless GoTaq Flexi Buffer (Promega Corp., WI, USA), 1.5 mM MgCl₂, 0.2 mM dNTP’s, 0.2 µM of each forward and reverse primer, 100 ng DNA, and 1.25 units GoTaq Hot Start Polymerase. PCR conditions were as follows: 94 °C 2 min, 35 cycles of 94 °C 30 s, 51 °C 30 s, 72 °C 1 min, and a final extension of 72 °C 5 min. An aliquot of the PCR product was run on a 1.5% w/v agarose gel to assess correct amplification. PCR products were isolated using the GeneJET PCR Purification kit (Thermo Fisher Scientific, Vilnius, Lithuania) following the manufacturer’s procedures and sent to Eurofins Genomics (Louisville, KY) for Sanger sequencing. Raw sequences were compared using BioEdit [29 ] and Multalin [30 (link)] software.

We used 11 microsatellite loci, SLN32, SLN34, SLN36, SLN54; SLN58, SLN62, SLN314, SLN319, SLN320, SLN510, and SLN511, previously developed for North Atlantic S. latissima (Paulino et al., 2016). PCR was used to amplify microsatellite alleles with ABI 9700 thermocyclers (Applied Biosystems, Inc., Foster City, CA). Each 10 µl PCR cocktail consisted of 2 µl template DNA diluted fourfold in deionized water mixed with (~0.1 µg/µl) 1× Colorless GoTaq Flexi Buffer (Promega Inc., Madison, WI), 1.5–2.5 mM MgCl₂ (Promega Inc., Madison, WI), 0.20 mM of each nucleotide (Applied Biosystems, Inc.), 0.10–0.25 µM of forward and reverse primers, 0.1 mg/ml of BSA (Sigma Inc., St. Louis, MO), 0.05 U GoTaq Flexi DNA polymerase (Promega Inc., Madison, WI), and deionized water. Thermal cycling profiles varied with locus (Table S1 in Appendix S1), and appropriate dyes were used to tag the amplified DNA fragments (Table S2 in Appendix S1). Amplicons were electrophoretically separated by size in an Applied Biosystems 3730 capillary DNA sequencer. Genotypes were scored with GeneMapper 5.0 (Applied Biosystems) independently by two technicians. 8% of the samples was re‐extracted and re‐genotyped by a third technician for quality control.

DNA isolation from blood was performed using a Wizard Genomic DNA Purification kit (Promega), according to manufacturer’s instructions. A human β-actin gene was used as a control to verify DNA integrity and the presence of possible PCR inhibitors [15 (link)].
Primers HM1 (5'-CCG CCC CTA TTT TAC ACC AAC CCC-3'), HM2 (5'-GGG GAG GGG CGT TCT GCG AA-3'), and HM3 (5'-GGC CCA CTA TAT TAC ACC AAC CCC-3') were employed to amplify the 120-bp fragment of the conserved region of Leishmania kDNA minicircle [16 (link)].
kDNA-PCR was performed with a final 25 μL volume containing 1x Colorless GoTaq Flexi buffer (Promega, Madison, USA), 200 μM dNTPs (dATP, dCTP, dGTP, and dTTP; Promega), 1.5 mM MgCl₂, a 1 μM concentration of each primer, roughly 150 ng of extracted DNA, and water to complete the reaction. In all reactions, 2 μL of Leishmania (Viannia) braziliensis genomic DNA (MHOM/BR/1975/M2903, LIPMed-Fiocruz, Rio de Janeiro) served as the positive control. The negative control was a sample containing the reagent mixture devoid of DNA. Cycling started at 95 °C for 2 min, followed by 35 cycles at 95 °C for 30 s, 54 °C for 30 s, 72 °C for 30 s, and a final extension at 72 °C for 7 min.
Amplification was verified by performing 2% agarose gel electrophoresis in 0.5x TBE buffer, followed by gel staining with GelRed (1:500).

The DNA of the bacterial isolates and controls were amplified with 0.3 μM primers [LPW57 5′-AGTTTGATCCTGGCTCAG-3′ (nucleotide position 10–27) and LPW58 5′-AGGCCCGGGAACGTATTCAC-3′ (nucleotide position 1370–1389)]^{19 (link)} using GoTaq® MDx Hot Start Polymerase and Colorless GoTaq® Flexi Buffer (Promega). PCR amplification was performed on a PTC-100 thermocycler (Bio-Rad) using the following conditions: an initial incubation at 94 °C for 2 min, 25 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, followed by a final incubation at 72 °C for 5 min. PCR products were purified using DNA Clean & Concentrator (Zymo Research). DNA sequencing was performed by the GATC company (Cologne, Germany) using the PCR primers. 16S rRNA gene sequences were subjected to BLAST analysis against the NCBI nucleotide database. The sequencing data analysis allowed assigning species when the similarity score was 99% or higher and the similarity score differences with the next closest species were equal to or greater than 0.2%, which reflected 3 or more nucleotides. The genus was assigned when the similarity score was 97% or higher. The BLAST analysis of the 16S rRNA gene sequences was verified against the curated leBiBi-QBPP database (https://umr5558-bibiserv.univ-lyon1.fr/lebibi/lebibi.cgi) not revealing any differences in identification.

For PCR amplification, Lambda DNA (New England Biolabs Japan, Tokyo, Japan) served as the template. A defined copy number of the template was introduced into a 25 µL solution comprising 1× Colorless GoTaq Flexi Buffer (Promega K.K., Tokyo, Japan), 0.5 g/L bovine serum albumin (Sigma-Aldrich Japan, Tokyo, Japan), 1.5–8 mM Mg²⁺ (FUJIFILM Wako Pure Chemical Co., Tokyo, Japan), 300 µM dNTPs, 0.2 µM forward and reverse primers (Integrated DNA Technologies (IDT), Coralville, IA, USA) targeting a 76 bp product, 0.2 µM probe DNA (IDT), and 0.625 U GoTaq DNA polymerase (Promega K.K.). The primer set and HEX-labeled probe with BHQ-2 at the 5′ and 3′ ends, respectively, matched those employed in our prior studies [34 (link),35 (link)].

The PCR mixture contained 5 μl of DNA extract and 20 μl of a mix composed of 0.625 U of GoTaq^® Hot Start Polymerase (Promega, Charbonnières-les-Bains), 1x Colorless GoTaq^®Flexi Buffer (Promega), 2mM of MgCl2 (Promega), 0.8mM of dNTP mix (Eurobio, Les Ulis), and 0.2 μM of each primer. The amplification program consisted of 5 min at 94°C, 30 cycles of 30 s at 94°C, 30 s at 58°C, and 1 min at 72°C, followed by a final step of 10 min at 72°C. Sequences of resistant strains were compared to the wild-type A. fumigatus sequence CM 237 (GenBank accession number AF338659), at http://blast.ncbi.nlm.nih.gov/Blast.cgi.