The largest database of trusted experimental protocols

32 protocols using lentiviral particles

1

Stable Gal-3 Knockdown in TPIN Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
TPIN071122 cells were stably infected with Gal-3 shRNA Lentiviral Particles or with control shRNA Lentiviral Particles (Sigma) at 10 MOI, according to the manifacturer's protocol, to generate TPIN-SCshGal3#5 and TPIN-SCshScram, respectively. Briefly, 5 × 104 cells/well were plated in a mixture of medium and Polybrene (Sigma). At day 2 Lentiviral Particles were added. At day 4 after infection, 2 μg/ml of puromycin dihydrochloride (Sigma) were added to select cells that had integrated the Lentiviral Particles.
+ Open protocol
+ Expand
2

Knockdown of Estrogen Receptor Alpha

Check if the same lab product or an alternative is used in the 5 most similar protocols
To achieve Esr1-KD, lentiviral particles (Sigma) carrying shRNA targeted to ERα were used to transduce C2C12 myoblasts. After selecting positive transformants with puromycin (5 µg/ml), the selected clones were expanded and analyzed for KD efficiency as measured by qRTPCR and immunoblotting. The resulting cultures were then used for subsequent assays in the undifferentiated and differentiated states.
+ Open protocol
+ Expand
3

Generating Stable SIRT1 Knockdown in H9 hESCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
To establish stable H9 expressing control or SIRT1 specific shRNA, H9 human ESCs
cells were infected with control or SIRT1 shRNA expressing lentiviral particles
(Sigma) and selected in the presence of 1 μg/mL of puromycin for 1 weeks.
The cells were maintained in the presence of 1 μg/mL of puromycin. The
knockdown level of SIRT1 gene was analyzed by western blotting with anti-SIRT1
antibody.
+ Open protocol
+ Expand
4

Knockdown of PKM2, HIF-1α, and CXCR4 genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
PKM2 shRNA Lentiviral Particles (Sigma-Aldrich) were used to knock down PKM2 mRNA expression in the PC-3 cell line, and shRNA Lentiviral Particles-A were used as control. Gene knockdown was confirmed using Western blot. Pre-designed siRNA for mouse HIF-1a and human CXCR4 were obtained from Thermo Fisher Scientific. Mouse HIF-1α siRNA was used to knock down the target genes in ST2 cells, and human CXCR4 siRNA was used to knock down the target genes in PC3-luc cells following the manufacturer’s instructions. Briefly, the cells were transfected with siRNA by using Lipofectamine RNAiMAX (Thermo Fisher Scientific) for 24 h, followed by validation of expected change in expression of the target gene using qPCR.
+ Open protocol
+ Expand
5

Investigating Lipotoxicity in Human Islets

Check if the same lab product or an alternative is used in the 5 most similar protocols
Islets from human cadaver donor pancreas were obtained via the NIDDK-sponsored Integrated Islet Distribution Program, CA. Details regarding the human islet donors used in this study are provided (Supplementary Table 1). After overnight recovery at 37 °C, islets were handpicked and used for western blot analyses and the TGF-β1 secretion assay. Similar sized 15 islets per well were treated with 0.5 mM palmitate (PA, Sigma) in 2% charcoal-treated FBS containing CMRL 1066 media (Gibco, ThermoFisher Scientific, Waltham, MA, USA) for 24 h and the TGF-β1 level measured in the media was normalized to protein extracted from 15 islets. For the apoptosis detection, handpicked islets were dissociated with trypsin at 37 °C and dispersed islets were used. Lentiviral particles containing nontargeting short hairpin RNA (CON) or shRNA against to FoxO1 (shFoxO1) were purchased from Dharmacon (Lafayette, CO, USA). The sequence of FoxO1 shRNA was 5′ -ACATATGGCCAATCCAGCA-3′. Dissociated T2D human islet cells were infected with control or shFoxO1 Lentiviral particles with polybrene (8 µg/ml) for 3 days and subsequently the islet cells were treated with for FFA palmitate or SB431542 (Sigma) for additional 24 h.
+ Open protocol
+ Expand
6

Lentiviral Knockdown of Target Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral particles encoding shRNA sequences for specific target genes were obtained from Sigma. MEFs or H9c2 cells were seed at appropriate density in growth media containing 5 μg/ml hexadimethrine bromide (Sigma), and cells were then infected by adding shRNA Lentiviral particles to the culture. Stable clones expressing the shRNA were selected using 2–10 μg/ml puromycin dihydrochloride. shRNA-mediated knockdown was confirmed by western blotting.
+ Open protocol
+ Expand
7

Stable USP24 Knockdown in HCT116 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HCT116 cells stably transduced with the CherryOFF-GFP reporter were
employed for further USP24-knockdown or a mock knockdown control. Lentiviral
particles were purchased from Sigma Aldrich encoding shRNA sequences against
human USP24 and nonsilencing control (SHCLNV-NM_015306 and SHC002V). 5uL of
lentiviral particles were used to infect a 60mm dish of HCT116 cells, and
then selected with 5ug/mL puromycin. USP24 knockdown efficiency was
quantified via western blot using a rabbit-anti-USP24 antibody (Origene
TA5240) compared to tubulin control (Santa Cruz H-235)
+ Open protocol
+ Expand
8

Generating Stable Lung Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary normal human lung fibroblasts (NHLFs) were cultured in FGMTM-2 Fibroblast Growth Medium-2 Bullet Kit (Lonza). Human lung fibroblast lines (MRC-5 and IMR-90) and the human lung epithelial cell line (A549) were cultured in DMEM containing 10% FBS, penicillin and streptomycin (Pen+Strep), plus supplements of L-glutamine, sodium pyruvate, and non-essential amino acid (NEAA). RAW264.7 cells were cultured in complete RPMI. Cells were washed in PBS and detached from culture flasks with 5 ml Accutase.
To generate cell lines with stable transgene expression, lentiviral particles were purchased commercially (Sigma) or generated by the AbbVie lentiviral core facility. To enhance transduction efficiency, polybrene was added to the filtered supernatants (5 µg/ml) prior to transduction of A549 and RAW264.7 cells via spin-fection at 1250 x g for 60 min at room temperature. For establishing the pSTAT3 luciferase reporter RAW264.7 cell line, cells expressing the reporter construct were selected by puromycin (10 µg/ml), single cell cloning was performed to isolated stable clones via the standard limiting dilution approach.
+ Open protocol
+ Expand
9

UHRF1 Knockdown Using Lentiviral CRISPR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral particles were purchased from Sigma-Aldrich using the LentiCRISPR platform. UHRF1 targeting used the gRNA sequence TCCCGTCCATGGTCCGAACC in the pLV-U6g-EPCG vector, with viral titer by p24 antigen ELISA of 8.8 x 106 TU/ml. CRISPR lentivirus non-targeting control particles utilizing the identical pLV-U6g-EPCG vector were also purchased from Sigma-Aldrich (Lot 10201511MN), with p24 antigen ELISA titer 2.9x107 TU/ml. Reh cells (1x105) were combined with viral particles at multiplicity of infection (MOI) 2, in 0.5 ml RPMI media supplemented with 10% FBS and Polybrene 4 μg/ml (Millipore), and centrifuged for 60 minutes at 800x g at 32°C. Cells were grown in RPMI with 10% FBS for 72 hours and subsequently selected with 1 μg/ml Puromycin followed by clonal dilution and evaluation by PCR and Western blot.
+ Open protocol
+ Expand
10

Ovarian Cancer Cell Line Establishment

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cell lines used in this study were obtained from the American Type Culture Collection (Manassas, VA, USA). Cells were maintained in RPMI-1640 (SH30027; Hyclone, Marlborough, MA, USA) supplemented with 10% fetal bovine serum (12483-020; Gibco, Waltham, MA, USA) in a 5% CO2 atmosphere at 37℃. The immortalized human ovary epithelial cell line (HOSE2) was obtained as a gift from Dr. Tohru Kiyono (National Cancer Center, Tokyo, Japan).14 (link) To establish stable 14-3-3ζ-knockdown cell lines and corresponding controls, lentiviral particles containing 14-3-3ζ or control short hairpin RNA were transduced into TOV21G ovarian cancer cells, and stable cells were selected with puromycin (Sigma Aldrich, St. Louis, MO, USA). lentiviral particles were purchased from Santa Cruz Biotechnology.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!