Kasp genotyping assay

Manufactured by LGC

Sourced in United Kingdom, Germany

The KASP genotyping assay is a DNA-based technology developed by LGC for genetic analysis. It provides a reliable and efficient method for the detection and identification of specific genetic variants within a sample.

Automatically generated - may contain errors

Lab products found in correlation

Taqman snp genotyping assay, by Thermo Fisher Scientific (2 mentions) Abi 3130xl genetic analyzer, by Thermo Fisher Scientific (2 mentions) Porcinesnp60 beadchip, by Illumina (2 mentions) Dneasy blood and tissue kit, by Qiagen (2 mentions) Cfx384 touch cycler, by Bio-Rad (2 mentions) Bigdye terminator v1.1 cycle sequencing kit, by Thermo Fisher Scientific (2 mentions) Applied biosystems 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions) Hydrocycler 16, by LGC (1 mentions) Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions) Kasp genotyping platform, by LGC (1 mentions) Kasp snp genotyping assays, by LGC (1 mentions) Quickgene 810 nucleic acid isolation system, by Fujifilm (1 mentions) Lightcycler 480 system, by Roche (1 mentions) Kleargene xl dna extraction kit, by LGC (1 mentions) Bmg pherastar plate reader, by BMG Labtech (1 mentions) Snp viewer, by LGC (1 mentions) Lightcycler 480 real time pcr system, by Roche (1 mentions) Genomestudio software, by Illumina (1 mentions) Abi 7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions) Flexigene dna kit, by Qiagen (1 mentions)

34 protocols using kasp genotyping assay

Genotyping of rs1021737 SNP in CTH

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The rs1021737 (S403I) SNP in CTH was selected based on previous published evidence of functional consequences to CTH function [57 (link),80 (link)]. Genotyping of rs1021737 was performed using KASP genotyping assays (LGC Genomics, Hoddesdon, UK) in an Applied Biosystems 7500 Fast Real-Time PCR system (Thermo Fisher Scientific), according to the manufacturer’s instructions. Mean call rate for the SNPs was >98%.

Sueiro-Olivares M., Scott J., Gago S., Petrovic D., Kouroussis E., Zivanovic J., Yu Y., Strobel M., Cunha C., Thomson D., Fortune-Grant R., Thusek S., Bowyer P., Beilhack A., Carvalho A., Bignell E., Filipovic M.R, & Amich J. (2021). Fungal and host protein persulfidation are functionally correlated and modulate both virulence and antifungal response. PLoS Biology, 19(6), e3001247.

+ Open protocol

+ Expand

Genetic Variants Associated with Atrial Fibrillation

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The methods for DNA extraction and also the SNP genotyping and analysis of this study have been described previously in detail [20 (link)]. In brief, we used whole blood and isolated the total genomic DNA using LGC’s Kleargene™ silica-based DNA extraction technique, which was performed at LGC Genomics. Isolated DNA was then analyzed using UV spectrophotometry to estimate both the quality and quantity of the DNA and normalized.
Based upon the results of previous genetic association studies, 24 common genetic variants known to be associate with AF [9 (link)–12 (link), 14 (link), 16 (link), 17 (link), 21 (link)–27 (link)] were selected for SNP genotyping in both the cases and controls. SNP genotyping was performed using KASP™ genotyping assays from LGC genomics (http://www.lgcgenomics.com). For each SNP two allele specific forward primers and one reverse primer were designed (LGC Genomics, Hoddesdon, UK) as described in detail previously [20 (link)]. All assays were conducted without any knowledge of case or control status. Genotypes for all SNPs passed our quality-control threshold (call-rate ≥ 94%; Hardy-Weinberg equilibrium P > 0.05 in control subjects).

Jabbari R., Jabbari J., Glinge C., Risgaard B., Sattler S., Winkel B.G., Terkelsen C.J., Tilsted H.H., Jensen L.O., Hougaard M., Haunsø S., Engstrøm T., Albert C.M, & Tfelt-Hansen J. (2017). Association of common genetic variants related to atrial fibrillation and the risk of ventricular fibrillation in the setting of first ST-elevation myocardial infarction. BMC Medical Genetics, 18, 138.

+ Open protocol

+ Expand

TaqMan and KASP SNP Genotyping Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

TaqMan SNP Genotyping Assays (Applied Biosystems) or KASP genotyping assays (LGC Genomics) were used for the analysis of the SNPs. Case and control samples were amplified simultaneously in 384 well format (Hydrocycler 16 (LGC Genomics), using 3 ng whole genome amplified DNA from blood). Endpoint genotype detection was carried out on the ViiA 7 Real-Time PCR System (Applied Biosystems). Call rates for 40 out of 41 SNPs were 94–99%. Internal quality controls showed a concordance rate of ≥ 99%. Samples with < 50% call rate over all assays were excluded from the study.

Huhn S., da Silva Filho M.I., Sanmuganantham T., Pichulik T., Catalano C., Pardini B., Naccarati A., Polakova-Vymetálkova V., Jiraskova K., Vodickova L., Vodicka P., Löffler M.W., Courth L., Wehkamp J., Din F.V., Timofeeva M., Farrington S.M., Jansen L., Hemminki K., Chang-Claude J., Brenner H., Hoffmeister M., Dunlop M.G., Weber A.N, & Försti A. (2018). Coding variants in NOD-like receptors: An association study on risk and survival of colorectal cancer. PLoS ONE, 13(6), e0199350.

+ Open protocol

+ Expand

Genotyping of TREM2 and PLD3 Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from whole blood samples as described previously (Engelman, et al., 2013 (link)). Genotyping of the TREM2 variant R47H (rs75932628) and PLD3 variants V232M (rs145999145) and A442A (rs4819; splice site variant) was performed using competitive allele-specific PCR based KASP^™ genotyping assays (LGC Genomics, Beverly, MA). The quality control process has been described previously (Darst, et al., 2016 (link)). The PLD3 splice site variant, A442A, was monomorphic in our sample. Consequently, no genetic association analysis could be performed on this variant. The other PLD3 variant and the TREM2 variant were in Hardy-Weinberg equilibrium.

Engelman C.D., Darst B.F., Bilgel M., Vasiljevic E., Koscik R.L., Jedynak B.M, & Johnson S.C. (2017). The effect of rare variants in TREM2 and PLD3 on longitudinal cognitive function in the Wisconsin Registry for Alzheimer’s Prevention. Neurobiology of aging, 66, 177.e1-177.e5.

+ Open protocol

+ Expand

APOE Genotyping by Competitive Allele-Specific PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

APOE genotyping was performed by competitive allele-specific PCR, using KASP™ genotyping assays (LGC Genomics, Hoddesdon, UK) for both rs7412 and rs429358. Subsequent genotype data was converted into APOE allele status [70 (link)]. Full methods for the KASP™ genotyping platform are available from LGC Genomics (http://www.lgcgenomics.com/genotyping/kasp-genotyping-reagents/).

Ritchie D.L., Adlard P., Peden A.H., Lowrie S., Le Grice M., Burns K., Jackson R.J., Yull H., Keogh M.J., Wei W., Chinnery P.F., Head M.W, & Ironside J.W. (2017). Amyloid-β accumulation in the CNS in human growth hormone recipients in the UK. Acta Neuropathologica, 134(2), 221-240.

+ Open protocol

+ Expand

Genetic Analysis of Complement Activation in AMD

Check if the same lab product or an alternative is used in the 5 most similar protocols

Venous blood was obtained for genetic analysis and the measurement of the complement components C3 and C3d. Complement component C3 and the activation fragment C3d were measured in serum samples as described previously.[29 (link)] The C3d/C3 ratio was calculated as a measure of complement activation. Genomic DNA was extracted from peripheral blood samples using standard procedures. Genotyping of nine single nucleotide polymorphisms (SNPs) known to be associated with AMD, in the ARMS2 (rs10490924), CFH (rs1061170, rs800292, and rs12144939), C3 (rs2230199 and rs1047286), CFB (rs4151667 and rs641153), and CFI (rs10033900) genes was performed in at least 85% of the included subjects with KASP™ genotyping assays (LGC Genomics) according to the manufacturer’s instructions. Genotype frequencies in the control individuals were tested for Hardy-Weinberg equilibrium.

Saksens N.T., Lechanteur Y.T., Verbakel S.K., Groenewoud J.M., Daha M.R., Schick T., Fauser S., Boon C.J., Hoyng C.B, & den Hollander A.I. (2016). Analysis of Risk Alleles and Complement Activation Levels in Familial and Non-Familial Age-Related Macular Degeneration. PLoS ONE, 11(6), e0144367.

+ Open protocol

+ Expand

Variant Validation via Genotyping and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Variant-specific KASP genotyping assays (LGC Genomics, Hoddesdon, UK) and/or direct automated (Sanger) sequencing were used to validate all the variants in the candidate genes. Sequencing was performed at STAB VIDA (Caparica, Portugal) and Macrogen (Amsterdam, the Netherlands) and data was analysed with SeqMan Pro (Lasergene 13, DNASTAR, Madison, WI). The primers used for amplification and sequencing were the same as the ones used to amplify the pooled DNAs.

Fernández-Rozadilla C., Álvarez-Barona M., Quintana I., López-Novo A., Amigo J., Cameselle-Teijeiro J.M., Roman E., Gonzalez D., Llor X., Bujanda L., Bessa X., Jover R., Balaguer F., Castells A., Castellví-Bel S., Capellá G., Carracedo A., Valle L, & Ruiz-Ponte C. (2021). Exome sequencing of early-onset patients supports genetic heterogeneity in colorectal cancer. Scientific Reports, 11, 11135.

+ Open protocol

+ Expand

Genomic DNA Isolation and SNP Genotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood (EDTA-preserved) was used for isolation of genomic DNA using the QuickGene-810 Nucleic Acid Isolation System (Fujifilm, Life Science Products, Tokyo, Japan) and quantified on a NanoDrop ND-1000 spectrophotometer (Saveen Werner, Limhamn, Sweden).
The SNPs were analyzed using KASP SNP genotyping assays (LGC Genomics, Hoddesdon, UK), which facilitates bi-allelic discrimination through a competitive PCR and incorporation of a fluorescent resonance energy transfer quencher cassette. KASP genotyping assays were designed by LGC Genomics toward the following sequences: rs10407022, CTCCAGGCA[T/G]CCCACAAGAGC and rs11170547, GTTCTCCCTTTCAC[C/T]TACTAACACTAATTTG. A standard touch-down PCR program, as advised from the manufactures, was used to discriminate alleles. The annealing temperature was decreased by 0.6°C in 10 cycles from 61°C to 55°C for AMHR2 rs11170547 C>T and from 68°C to 62°C for AMH rs10407022 T>G.

Greiber I.K., Hagen C.P., Busch A.S., Mieritz M.G., Aksglæde L., Main K., Almstrup K, & Juul A. (2018). The AMH genotype (rs10407022 T>G) is associated with circulating AMH levels in boys, but not in girls. Endocrine Connections, 7(2), 347-354.

+ Open protocol

+ Expand

Genotyping rs383232842 in Cattle Breeds

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotypes for rs383232842 were obtained in 661 Braunvieh, 3807 Fleckvieh and 503 Holstein animals using a customized KASP™ genotyping assay (LGC Genomics) (FAM/HEX/reverse primer sequence: TGTTCATGAGAACGATGCTGTTCG/CTTGTTCATGAGAACGATGCTGTTCA/TGCTTGATATTCATCAGCTTCACACAGAT).

Schwarzenbacher H., Burgstaller J., Seefried F.R., Wurmser C., Hilbe M., Jung S., Fuerst C., Dinhopl N., Weissenböck H., Fuerst-Waltl B., Dolezal M., Winkler R., Grueter O., Bleul U., Wittek T., Fries R, & Pausch H. (2016). A missense mutation in TUBD1 is associated with high juvenile mortality in Braunvieh and Fleckvieh cattle. BMC Genomics, 17, 400.

+ Open protocol

+ Expand

Candidate Gene Selection for Stress Response

Check if the same lab product or an alternative is used in the 5 most similar protocols

To assess genetic variation possibly underlying the evaluated traits, candidate genes were selected as described in Cuervo-Alarcon et al.^{45 (link)}. In brief, based on previous studies on SNP discovery in European beech^{63 (link)–65 (link)}, candidate genes that very likely participate in stress response according to the UniProt (www.uniprot.org) and the Arabidopsis Information Resource (TAIR) (www.arabidopsis.org) databases^{122 (link),123 (link)} were selected. SNPs for genotyping in those genes were chosen based on their identification as haplotype tag SNPs by the software htSNPer 1.0^{124 (link)} or because they already showed signs of natural selection in previous studies^{66 (link),68 (link)}. For primer design, sequences surrounding the SNPs were sent to LGC Genomics Ltd. where SNP genotyping was performed using the PCR-based KASP genotyping assay (Hoddesdon, UK). In total, 70 polymorphic SNPs in 23 candidate genes were genotyped in the saplings and represented 19 non-synonymous, 26 synonymous and 25 non-coding SNPs (Supplementary Table S12).

Cuervo-Alarcon L., Arend M., Müller M., Sperisen C., Finkeldey R, & Krutovsky K.V. (2021). A candidate gene association analysis identifies SNPs potentially involved in drought tolerance in European beech (Fagus sylvatica L.). Scientific Reports, 11, 2386.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!