Plasma serum circulating and exosomal rna purification mini kit slurry format

RNA was isolated from serum samples using the Plasma/Serum Circulating and Exosomal RNA Purification Mini Kit (Slurry Format) (Norgen Biotek Corporation, Thorold, Ontario, Canada, L2V4Y6) according to manufacturer’s instructions. Briefly, 0.3 mL of Slurry C2 solution and 2.7 mL of Lysis Buffer A were added to 1.5 mL of serum and mixed well. The mixture was incubated for 10 minutes at 60°C. After incubation, 4.5 mL of 100% ethanol was added into the tubes and mixed well. The tubes were centrifuged for 30 seconds at 201 g (1000 RPM), and then the supernatants were discarded. Lysis buffer A (0.45 mL) was added into the tubes again to dissolve the slurry pellet and incubated for another 10 minutes at 60°C. After adding 0.45 mL of ethanol, the mixtures were loaded onto the provided column and centrifuged for 1 minute at 20871 g (14000 RPM). After discarding the eluate and washing the column with 400 μL of Wash Solution A for 3 times, 100 μL of Elution Solution A was applied to the column, centrifuged and collected the eluate. The concentration and purity of Eluted RNA were determined by NanoDrop 1000 (Thermo Fisher Scientific, Wilmington, DE). The yields of total eluted RNA were 140–360 ng per 1500μL of serum.

Plasma aliquots were thawed on ice and centrifuged at 800 × g for 10 min at 4 °C to minimise cellular and platelet RNA contamination^{27 (link)}. The upper 750 μl was removed for processing and the remaining plasma was discarded. RNA was extracted using the ‘Plasma/Serum Circulating and Exosomal RNA Purification Mini Kit (Slurry-Format)’ (Norgen-Biotek, Ontario, Canada). A spike-in of 5000 attomoles of synthetic cel-254 (sequence:UGCAAAUCUUUCGCGACUGUAGG, Integrated DNA Technologies BVBA, Leuven, Belgium) was added following the addition of lysis and denaturing buffers to allow downstream normalisation of any technical variation to the extraction process. Eluted RNA was further purified and concentrated using Amicon Ultra YM-3 columns (Millipore, Darmstadt, Germany) to a final volume of 25 μl.

Total RNA was extracted from cells and tissues by a TRI Reagent (MRC, Cincinnati, OH, USA) according to the manufacturer’s instructions.
Cell-free RNAs were isolated from plasma and exosomal samples using a Plasma/Serum Circulating and Exosomal RNA Purification Mini Kit (Slurry Format; NORGEN, Thorold, ON L2V 4Y6 Canada), according to the manufacturer’s instructions. For normalization, 5 pg of Syn-cel-miR-39-3p miScript miRNA Mimic (QIAGEN) was added as an external control to each lysis sample.