Abi prism 7300 real time pcr detection system

Total RNA was extracted from approximate 50 ul embryos at embryonic stage 14 with TRIzol (Invitrogen). 1μg of RNA samples were treated with RQ1 DNase (Promega) and reverse transcribed using PrimeScript RT Master Mix (TaKaRa). Relative quantification PCR was carried out using a SYBR Premix Ex TaqTM II kit (Takara) and an ABI PRISM 7300 real-time PCR Detection system (Applied Biosystems). Relative mRNA levels were calculated using the comparative CT method. Rp49 was used as an internal control, and gene expression levels were normalized to treatment control or genetic control. Three separate samples were collected from each condition, and measurements were conducted in triplicates. The primers of fz for q-PCR were fz-qPCR-exon1-F: TGCAACTGAAAACGCCTCT; fz-qPCR-exon2-R: AAACGGCCAA GAAGACAATG. The primers of rp49 were rp49-RT-F: AGGGTATCGACAACAGAGTG; rp49-RT-R: CACCAGGAACTTCTTGAATC

Total RNA was extracted from 8 fly bodies or ∼100 fly heads with TRIzol (Invitrogen). RNA samples were treated with RQ1 DNase (Promega) and reverse-transcribed using PrimeScript RT Master Mix (TaKaRa). Relative quantification PCR was carried out using a SYBR Premix Ex TaqTM II kit (Takara) and an ABI PRISM 7300 real-time PCR Detection system (Applied Biosystems). Relative mRNA levels were calculated using the comparative CT method. Rp49, Dp and Actin 5C, were used as the internal control, and gene expression levels were normalized to treatment control or genetic control. Three separate samples were collected from each condition, and measurements were conducted in triplicates.

The effectiveness of all innexin RNAi lines were verified with Quantitative Real Time PCR (qPCR). Total RNA extracted from approximately 100 fly heads with TRIzol (Invitrogen, Carsbad, California) was treated with RQ1 DNase (Promega, Fitchburg, Wisconsin) and reverse-transcribed using PrimeScript RT Master Mix (Takara, Japan). Relative quantification PCR was accomplished using a SYBR Premix Ex TaqTM II kit (Takara, Japan) and an ABI PRISM 7300 real-time PCR Detection system (Applied Biosystems, Waltham, Massachussetts). Rp49 was used as an internal control and relative mRNA levels were calculated with the comparative CT method. Gene expression levels of all manipulated flies (elav-Gal4/UAS-inx RNAi) and control flies (UAS-inx RNAi/+) were normalized to elav-GAL4/+. Three separate samples were collected from each condition and measurements were conducted in triplicates.