Novaseq 6000 s4 reagent kit v1

Extracted DNA was sequenced on both the Illumina and Oxford Nanopore platforms. The short reads produced by Illumina technology were used to estimate genome size and correct errors in the assembled genome. Long reads from the Oxford Nanopore device, on the other hand, were used in the actual genome assembly process. For the Illumina platform, the library was prepared using the Illumina DNA Prep kit 20060060 and sequenced on the Illumina Novaseq 6000 sequencer using S4 flowcell and Novaseq 6000 S4 reagent kit v1.5 (300 cycles). In addition, another library with an average length of 20 kilobases was created using the Oxford Nanopore platform in line with the manufacturer’s instructions. The library was prepared using the Nanopore Ligation sequencing kit and sequenced on the PromethION 24 (P24) platform using FLO-PRO002 R9.4.1 as well as FLO-PRO112 R10.4.

The extraction of total DNA from the ileal contents was performed using an OMG-soil kit in Carlsbad, CA, USA. according to manufacturer’s instructions. he concentration and purity of the samples were assessed using a TBS-380 (Promega, Madison, WI, USA) and a NanoDrop™ 2000 (Thermo Fisher Scientific, Waltham, MA, USA). DNA extract quality was checked on 1% agarose gel.
DNA extract was fragmented to an average size of about 400 bp using Covaris M220 (Gene Company Limited, China) for paired-end library construction. Paired-end library was constructed using NEXTFLEX Rapid DNA-Seq (Bioo Scientific, Austin, TX, USA). Adapters containing the full complement of sequencing primer hybridization sites were ligated to the blunt-end of fragments. Paired-end sequencing was performed on Illumina NovaSeq (Illumina Inc., San Diego, CA, USA) at Majorbio Bio-Pharm Technology Co., Ltd. (Shanghai, China) using NovaSeq 6000 S4 Reagent Kit v1.5 (300 cycles) according to the manufacturer’s instructions.

Total genomic DNA was extracted from soil and roots samples using the Mag-Bind^® Soil DNA Kit (Omega Bio-tek, Norcross, GA, U.S.) according to manufacturer’s instructions. Concentration and purity of extracted DNA was determined with TBS-380 and NanoDrop2000, respectively. DNA extract quality was checked on 1% agarose gel. The PCR primers 338F (5′- ACTCCTACGGGAGGCAGCAG-3′) and 806R (5′- GGACTACHVGGGTWTCTAAT -3′) were used to amplify bacterial 16S rRNA, and ITS1F (5′- GCTGCGTTCTTCATCGATGC -3′) and ITS2R (5′- GCTGCGTTCTTCATCGATGC-3′) were used to amplify fungal ITS. DNA extract was fragmented to an average size of about 400 bp using Covaris M220 (Gene Company Limited, China) for paired-end library construction. Paired-end library was constructed using NEXTFLEX Rapid DNA-Seq (Bioo Scientific, Austin, TX, USA). Adapters containing the full complement of sequencing primer hybridization sites were ligated to the blunt-end of fragments. Paired-end sequencing was performed on Illumina NovaSeq (Illumina Inc., San Diego, CA, USA) at Majorbio Bio-Pharm Technology Co., Ltd. (Shanghai, China) using NovaSeq 6000 S4 Reagent Kit v1.5 (300 cycles) according to the manufacturer’s instructions.¹ Sequence data associated with this project have been deposited in the NCBI Short Read Archive database.