The BEAS-2B, A549, H1299 and H358 cell lines were obtained from the Jiangxi Key Laboratory of Molecular Medicine (1 Minde Road, Nanchang, Jiangxi Province). The cell culture conditions were as follows: DMEM (Solarbio, 11995) + 10% FBS (Solarbio, S9020) at 37°C and 5% CO2. The steps of quantitative real-time PCR (qRT-PCR) were as follows: Total RNA was isolated from the cells using Trizol reagent (Trizol reagent, Ambion, China), and the extracted total RNA was reverse transcribed to cDNA using PrimeScriptTM RT reagent Kit with cDNA Eraser (TaKaRa) reagent, and stained using TB Green Premix Ex TaqTM II (TaKaRa) for staining, and the expression levels of the mRNAs of the 4 genes were detected according to the intensity of the fluorescent signals. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA expression level was used as an endogenous control. Three experiments were performed for each sample, and the results were used to calculate the expression values of the 4 genes according to Equation 2-ΔΔCt. The primer sequences are shown in Supplementary Table S2
Primescript rt reagent kit with cdna eraser
Manufactured by Takara Bio
Sourced in China, Japan
The PrimeScript RT Reagent Kit with cDNA Eraser is a laboratory equipment product that enables the reverse transcription of RNA into complementary DNA (cDNA). The kit includes reagents necessary for this process, including the PrimeScript Reverse Transcriptase enzyme and a cDNA Eraser component.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (22 mentions)
Sybr premix ex taq, by Takara Bio (11 mentions)
Abi 7900 system, by Thermo Fisher Scientific (7 mentions)
Trizol, by Takara Bio (3 mentions)
Cfx96 real time pcr system, by Bio-Rad (2 mentions)
First strand synthesis kit, by Takara Bio (2 mentions)
Nanodrop one, by Thermo Fisher Scientific (2 mentions)
Sybr qrt pcr kit, by Takara Bio (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Tb green premix ex taqtm 2, by Takara Bio (1 mentions)
Fetal bovine serum (fbs), by Solarbio (1 mentions)
Dulbecco modified eagle medium (dmem), by Solarbio (1 mentions)
Minibest universal rna extraction kit, by Takara Bio (1 mentions)
Abi 7900ht thermocycler, by Thermo Fisher Scientific (1 mentions)
Nanodrop nd 2000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
2100 bioanalyzer, by Agilent Technologies (1 mentions)
Dnase 1, by Qiagen (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Cfx96 system, by Bio-Rad (1 mentions)
29 protocols using primescript rt reagent kit with cdna eraser
1
Quantitative Real-Time PCR Analysis of Cell Lines
2
Comprehensive RNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using a MiniBEST Universal RNA extraction kit (Takara Biotech, China) based on the manufacturer’s instructions. The yield and purity of total RNA were determined at 260 nm (A260) absorbance and 260/280 nm (A260/280) ratio by using NanoDrop ND-2000 spectrophotometer (Thermo Fisher Scientific). The RNA integrity and RNA integrity number (RIN) were assessed by agarose gel and 2100 Bioanalyzer (Agilent Technologies), respectively. The RIN is a number on a scale from 1 to 10, value of 10 indicates intact and non-fragmented RNA, and value of 1 represents completely degraded RNA29 (link). In addition, the total RNA was treated with DNase I (Qiagen) for 30 min at 37 °C to avoid contamination of genomic DNA. Meanwhile, a negative control without cDNA was also included ensure that the reagents were not contaminated. Total RNA (1 μg) from each sample was reverse transcribed via a PrimeScriptTM RT reagent kit with cDNA Eraser (Takara Biotech, China). The resulting cDNA was diluted (1:10) with sterile deionized water and used in qRT-PCR via ABI 7900HT thermocycler (Applied Biosystems).
3
Expression Analysis of Arabidopsis NHX Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Col-0 seedlings growing on MS plates were collected at 7-, 14- and 21-day growth. The total RNA was isolated using the RNAiso Plus (TaKaRa). The first-strand cDNA was synthesized from the total RNA (1 μg) using the PrimeScript® RT reagent kit with cDNA Eraser (TaKaRa), and was used as templates for PCR amplification. PCR amplification was performed with the CFX96 system (Bio-Rad) using the SYBR® Premix Ex Taq™ (TaKaRa). The Arabidopsis Actin7 gene was used as an internal control, and differences in product levels among the tested samples during the linear amplification phase were used to calculate the differential gene expression [43 (link)]. The gene-specific primers used are as follows: AtNHX5 (5′-CATGATCTACCAGAGGGTCACG-3′ and 5′-CAGACATGGAGTCATCAAGATCG-3′), AtNHX6 (5′-GGAAGTGGATTCAGGACAAAAC-3′ and 5′-GTTGCTCCATGTTACCCTCATC-3′ ).
4
Transcriptional Analysis of Murine Spleen
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the spleen was extracted by using Trizol reagent (TIANGEN, Beijing, China) according to the manufacturer’s protocol. The RNA quality was examined by electrophoresis on a 1% agarose gel. One microgram of total RNA from each sample was reverse transcribed into cDNA using the PrimeScript RT reagent kit with cDNA eraser (TaKaRa, Dalian, China). The following PCR reaction program was applied: 3 min heating at 95 °C, followed by 40 cycles of denaturation (10 s at 95 °C), annealing (20 s at 57 °C), and extension (15 s at 72 °C). Primer pairs used for the reverse transcription were listed in Supplementary Table S1 . Relative mRNA expression levels of each target gene were calculated using the 2−∆∆Ct method.
5
Profiling of miRNA and mRNA Expression in Colorectal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from colorectal cancer cell lines and patient specimens using TRIzol reagent (Life Technologies) according to the manufacturer’s manual. One microgram of total RNA was used as template for cDNA synthesis using a PrimeScript RT Reagent Kit with cDNA Eraser (Takara Biotech, Dalian, China) and qRT-PCR was performed using SYBR Premix Ex Taq (Takara Biotech). MiRNA expression were performed in triplicate using SYBR PrimeScriptTM miRNA RT-PCR Kit (Takara Biotech). All qRT-PCR assays was performed on an ABI 7900 system (Applied Biosystems, Foster City, CA, USA). Expression levels of genes or miRNA were normalized to that of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or SNORD6 (U6 snRNA). 2−ΔΔCt method was applied for calculation of relative levels of genes and miRNA expression.
6
Quantifying mRNA Levels in Prostate Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from DU145 and PC-3 cells using Trizol reagent (Thermo Fisher Scientific, Waltham, MA, USA) and reverse transcribed into cDNA using a PrimeScript RT reagent kit with cDNA Eraser (TaKaRa, Dalian, China). Reverse transcription (RT) products were used as templates for subsequent qPCR.
The following primers were used in this study:
The mRNA levels of the target genes were analyzed by the ABI7900 Real-Time PCR Detection System (Applied Biosystems, Foster City, CA, USA) with Syber Green reagent (Thermo Fisher Scientific). GAPDH was used as an internal control for normalization. The specificity of the fluorescence signal was confirmed by both melting curve analysis and agarose gel electrophoresis. The mRNA levels of target genes were determined by the 2−ΔΔCt method.
The following primers were used in this study:
The mRNA levels of the target genes were analyzed by the ABI7900 Real-Time PCR Detection System (Applied Biosystems, Foster City, CA, USA) with Syber Green reagent (Thermo Fisher Scientific). GAPDH was used as an internal control for normalization. The specificity of the fluorescence signal was confirmed by both melting curve analysis and agarose gel electrophoresis. The mRNA levels of target genes were determined by the 2−ΔΔCt method.
7
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from colonic tissues or J774A.1 cells using TRIzol (Takara Bio, Otsu, Japan), and 1 μg RNA was reverse-transcribed using PrimeScript® RT Reagent Kit with cDNA Eraser (Takara Bio, Otsu, Japan). RT-qPCR was performed with gene-specific primers (Supplemental Table 3 ) and an SYBR Green master mix on an ABI 7300 real-time PCR system (Applied Biosystems, Foster, CA, USA). Relative fold changes of gene expression were calculated using the cycle threshold (Ct) method and β-actin or GAPDH as a reference gene as previously described.
8
Transcriptome Analysis of Cell Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the cells using TRIzol Reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions. Equal amounts of total RNA from each sample were reverse-transcribed into cDNA using the PrimeScript RT Reagent Kit with cDNA Eraser (Takara Bio, Kusatsu, Shiga, Japan). Real-time PCR was conducted using FastStart Universal SYBR Green Master Mix (Roche GmbH, Mannheim, Germany) and the expression levels were normalized to that of GAPDH. Primer sequences can be found in S1 Table .
9
RNA-seq Differential Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protein-coding gene expression levels in each sample were estimated according to fragments per kilo-base of exon per million fragments mapped and assessed with the analysis software Cufflinks v2.1.1 (Ghosh and Chan, 2016 (link)). P adjusted values were calculated using the Benjamini-corrected modified Fisher's exact test, Transcripts with a P adjusted value < 0.05, |fold change| > 1.5, were considered differentially expressed. The results of RNA sequencing were validated through qPCR. qPCR was performed using the LightCycler 480 real-time PCR system and SYBR Green PCR Master Mix (TaKaRa Biotechnology, Dalian, China). Total RNA was isolated from the ileac tissues using Trizol reagent (Invitrogen Life Technologies, Carlsbad, CA). cDNA was generated using the PrimeScript RT reagent kit with cDNA eraser (Takara, Dalian, China). The specific quantitative primers for 7 transcripts are listed in Supplementary Data 2 . Quantitative PCR assays were carried out using the SYBR Premix Ex TaqTM kit (Takara, Dalian, China). The conditions were 95°C for 2 min followed by 40 cycles (95°C for 20 s, 60°C for 30 s, and 68°C for 30 s). Each experiment was performed in triplicate. Target gene expression was quantified using the 2-△△CT method and normalized to the expression of glyceraldehyde-3-phosphate dehydrogenase.
10
Quantitative PCR analysis of liver gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The liver tissues were subjected to qRT-PCR analysis. RNA extraction and real-time PCR were performed as described in previous studies in our laboratory. Briefly, the total RNA from frozen liver tissues was extracted using TRIzol reagent (Cwbio Technologies, Beijing, China). cDNA was generated using the PrimeScript RT reagent kit with cDNA eraser (Takara, Dalian, China). Quantitative PCR assays were carried out using the SYBR® Premix Ex Taq™ kit (Takara, Dalian, China). Target gene expression was quantified using the 2-△△ Ct method and normalized to the expression of GAPDH. The primer sequences are summarized in Table 2 [43 (link)–45 (link)].
Primer sequences used in RT-PCR
| Gene | Primer sequence (5′–3′) |
|---|---|
| Bcl-2 | Forward: GACGACTTCTCCCGGCGCTA |
| Reverse: ACACATGACCCCACCGAAC | |
| Bax | Forward: CACCAAGAAGCTGAGCGAGT |
| Reverse: GCAAAGTAAAACAGGGCGACA | |
| Caspase-3 | Forward: AGATGTAAATGCAGCAAACCTC |
| Reverse: TCCTTCATCACCGTGGCTT | |
| Caspase-9 | Forward: ACATCCTCGTGTCCTACTCC |
| Reverse: TTGTAAATCCCTCGCTCGGAA | |
| GAPDH | Forward: GTTGTCGCCATCAATGATCCA |
| Reverse: TTCCCGTTCTCAGCCTTGACC |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!