According to the manufacturer's instructions, the total RNA from the tissue samples and cells was extracted by TRIzol reagent (Invitrogen, Carlsbad, California, USA). Then, the cDNA was synthesized with a PrimeScript RT reagent kit (Takara, Kyoto, Japan). Real-time qPCR analyses were performed with SYBR Green reaction system (Takara, Kyoto, Japan). The relative expression of ASF1b was quantified using the 2-ΔΔCT method, with GAPDH as the internal control. The specific primers sequences used were listed in Table I .
Sybr green reaction system
Manufactured by Takara Bio
Sourced in Japan
The SYBR Green reaction system is a fluorescent-based detection method used to quantify the amount of DNA in a sample. It functions by binding to double-stranded DNA, which emits a fluorescent signal that can be measured and correlated to the quantity of DNA present.
Automatically generated - may contain errors
5 protocols using sybr green reaction system
1
Quantifying ASF1b Expression in Tissues
2
Quantifying Gene Expression Using RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using the RNA isolation kit (Takara Biomedical Technology [Beijing] Co., Ltd.) to extract total RNA from cell lines, we used MMLV reverse transcriptase to synthesize cDNA using the SYBR Green reaction system (Takara Biomedical Technology [Beijing] Co., Ltd.) to amplify cDNA 37 (link). GAPDH was used as an internal reference to analyze the differences in mRNA expression levels of RB1, CDKN2B, CDKN2AIP, PCNA, KIAA0101, and MCM7. The PCR sequences were as follows: RB1: sense: 5'-GGAAGCAACCCTCCTAAACC-3', antisense: 5'-TTTCTGCTTTTGCATTCGTG-3'; CDKN2B: sense: 5'-CCAGAAGCAATCCAGGCGCG-3', antisense: 5'-CGTTGGCAGCClTCATCG-3'; CDKN2AIP sense: 5′- ATGGGCCAACAACGTGTTTC-3′, antisense: 5′-GAAAACAGGGGCATCCTCCA-3′; PCNA: sense: 5′-CCATCCTCAAGAAGGTGTTGG-3′, antisense: 5′-GTGTCCCATATCCGCAATTTTAT-3′; KIAA0101: sense: 5′-CCCAGGCAACATAGCGTAAA-3′, antisense: 5′-GGATGGTCTCGATCTCCTGA-3′; MCM7: sense: 5′-TCAATTTGTGAGAATGCCAGGCGC-3′, antisense: 5′-CACAGTTACCAACTTCCCCACAGA-3′; GAPDH: sense: 5′-TCCTGCACCACCAACTGCTTAG-3′, antisense: 5'-TCTTACTCCTTGGAGGCCATGT-3'.
3
Quantifying SSRP1 RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cell lines and human tissues using an RNA isolation kit (Takara Biomedical Technology (Beijing) Co., Ltd.). We used M‐MLV reverse transcriptase to synthesize cDNA. A SYBR Green reaction system (Takara Biomedical Technology (Beijing) Co., Ltd.) was used to amplify the cDNA. The differences in SSRP1 RNA expression were normalized to the corresponding GAPDH RNA signals. The PCR primers used were as follows: SSRP1: sense: 5‐GTGTTGTCAAAGGCGGATGT‐3, antisense: 5‐ACAAAGAACATCTGGCGCTG‐3; and GAPDH: sense: 5‐GTGGACATCCGCAAAGAC‐3, antisense: 5‐AAAGGGTGTAACGCAACTA‐3.
4
MAGP1 Gene Expression Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the tissue samples and cells using TRIzol reagent (Invitrogen, Carlsbad, California, USA) according to the manufacturer's instructions. One microgram RNA per sample was reverse transcribed to cDNA using the PrimeScript RT reagent kit (Takara, Kyoto, Japan), and the latter was amplified by qRT-PCR using the SYBR Green reaction system (Takara, Kyoto, Japan). The relative expression of MAGP1 was calculated by the 2-ΔΔCt method, with GAPDH as the internal control. The primer sequences were as follows: MAGP1 forward: 5′-CGCCGTGTGTACGTCATTAAC-3′ and reverse: 5′-CCATCACGCCACATTTGGA-3′, and GAPDH forward: 5′-GGAGCGAGATCCCTCCAAAAT-3′, and reverse: 5′-GGCTGTTGTCATACTTCTCATGG-3′.
5
Quantitative PCR Analysis of Fungal Challenge
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A Simgen kit (Simgen, Hangzhou, China) was used to extract total RNA from the anticoagulant blood samples collected 20 days after fungal challenge (n = 5/group). The Simgen’s Reverse Transcription Kit and First Strand cDNA Synthesis Kit (Simgen) were used for the fluorescence-based quantitative PCR. PCR primers were designed by using the NCBI/Primer-BLAST online server. The SYBR Green reaction system (Takara, Kyoto, Japan) was used in the fluorescence-based quantitative PCR strictly in accordance with the manufacturer’s instructions. Primers in the quantitative PCR reaction are listed in Table 1 . The reagents used in the PCR reaction included 10 µL 2 × Taq PCR master mix, 0.4 µL forward primer (10 µm), 0.4 µL reverse primer (10 µm), and 0.4 µL ROX Reference Dye II. The PCR reaction conditions were as follows: 1 cycle of 95 °C denaturation for 30 s; 40 cycles of 95 °C denaturation for 5 s, 60 °C annealing for 34 s; and 72 °C elongation for 10 s. Glyceraldehyde 3-phosphate dehydrogenase (Gapdh) was used as the endogenous housekeeping control gene. The target and housekeeping genes were analyzed in triplicate, and the average threshold cycle (CT) values were analyzed using the comparative CT method. Gene expression was reported as the fold difference relative to the calibrator. All data were given in terms of relative mRNA expression as mean ± SD.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!