Miseq lane

Genomic DNA from fecal swabs was extracted using the MoBio PowerSoil‐htp 96‐well Isolation Kit (Carlsbad, CA). A portion of the chloroplast trnL intron was PCR amplified using the g (5′‐GGGCAATCCTGAGCCAA‐3′) and h (5′‐CCATTGAGTCTCTGCACCTATC‐3′) primers for the trnL gene (Taberlet et al., 2007), but modified to include appropriate barcodes and adapter sequences for Illumina multiplexed sequencing. Unique per sample 12‐bp error‐correcting barcodes were used, as described in Caporaso et al. (2012). Each PCR was mixed per the Promega PCR Master Mix specifications (Madison, WI), with 2 μl of gDNA template for a reaction volume of 25 μl. The thermocycling program used an initial step at 94°C for 2 min, a final extension at 72°C for 2 min and the following steps cycled 35 times: 2 min at 94°C, 1 min at 55°C, and 30 s at 72°C.
Amplicon DNA yields from each PCR were then quantified using PicoGreen fluorometry (Thermo Fisher Scientific Inc.). All PCRs were normalized to equimolar concentrations and pooled together before purification using the MoBio UltraClean PCR Clean‐Up protocol. Sequencing was performed on a single Illumina MiSeq lane with 2 × 150 cycles at the University of Colorado Next‐Generation Sequencing Facility. We sequenced single sample per individual pig. Sequence processing was performed as described above.

Surface-sterilized cysts were crushed in a small centrifuge tube using a pestle. DNA was isolated from the macerated cysts according to a modified CTAB protocol described in Hu et al. (2017) (link). The DNA extracted from the 50 pooled cysts collected from each plot was used to construct a single metabarcode library, with four replicates per crop sequence at each collection time point. The PCR amplification, library preparation, and sequencing were conducted at the University of Minnesota Genomic Center, Saint Paul, MN, United States (Gohl et al., 2016 (link)). The universal bacterial primers targeting the 16S rRNA V4 region with primers 515F (GTGCCAGCMGCCGCGGTAA) and 806R (GGACTACHVGGGTWTCTAAT) were used. The Illumina index and flow cell adapters were amplified together with the V4 primers during the first step PCR, and dual-index barcode sequence was added at the second PCR step (Gohl et al., 2016 (link)). The samples from the same year were pooled and sequenced on one Illumina MiSeq lane with the 2 × 300 bp kit. For each paired-end lane of MiSeq, additional samples were included in order to assess the PCR and sequencing error in the downstream pipeline, including blank control samples, a mock community sample, which had equal amount of DNA isolated from pure bacterial cultures, and nine randomly chosen cyst samples for technical replicates.

Five half-sib seedlings from each A. tridentata ssp. wyomingensis (UTW1, 38.3279 N, 109.4352 W) A. tridentata ssp. tridentata (UTT2, 38.3060 N, 109.3876 W) and A. arbuscula ssp. arbuscula (CAV-1, 40.5049 N, 120.5617 W) were grown simultaneously in a petri dish on top of wetted filter paper for two days. No specific permissions were required for these locations and none of the species are endangered or protected. Seedlings were then flash frozen in liquid nitrogen and ground using a mortar and pestle. RNA was extracted using a Norgen RNA Purification Kit (Norgen Biotek Corp., Ontario, Canada). Sequencing libraries were prepared using an Illumina Tru-seq RNA Kit V2 (Illumina Inc., San Diego, California). Libraries were then pooled and multiplexed on an Illumina MiSeq lane and sequenced as 250 bp paired-end reads at the Center for Genome Research and Biocomputing, Oregon State University.

DNA and microbiome characterization from human fecal slurries, mouse cecal content, and mouse feces was extracted using a phenol:chloroform plus bead-beating protocol followed by 16S rRNA gene amplicon sequencing as previously described^{31 (link)}. Briefly, feces or cecal contents were subjected to bead-beating twice for 3 minutes in a mixture containing phenol:cholraphorm:isoamyl. alcohol (UltraPure^™ [25:24:1, v/v], ThermoFisher Scientific) and sodium dodecyl sulfate. The aqueous phase was collected, and DNA was precipitated by the addition of 1 M sodium acetate and 100% isopropanol. The DNA was then cleaned with the Neucleospin cleanup kit (Macherey-Nagel, Düren, Nordrhein-Westfalen, Germany) and the purified DNA was subjected to 16S rRNA gene amplicon sequencing. 16S rRNA gene amplicon libraries were prepared using V3-V4 universal primer sets with Illumina adapters and barcodes^{45 (link)}. The resulting libraries were loaded onto a single Illumina MiSeq lane (Illumina, San Diego, CA) at the University of Minnesota Genomics Center (Minneapolis, MN) which produced an average sampling depth of 36,196 ± 11,225 reads per sample. DADA2^{46 (link)} quality control and removal of chimeric reads was conducted with QIIME2^{47 (link)} (version 2022.2). Taxonomy was classified using the SILVA database^{48 (link)} (version 132).

Sample preparation, DNA extraction and PCR set-up were carried out in a dedicated aDNA laboratory at the Natural History Museum, London (NHM). PCR, qPCR and post-PCR work as well as DNA sequencing were carried out at the NHM, London. The DNA was extracted using a modified silica binding method [19 (link)], and PCR was amplified using primers specific to orang-utan, chimpanzee, gorilla or humans (electronic supplementary material, table S5). In order to infer robust consensus sequences and to monitor for contamination and miscoding lesions, we pooled the PCR products into equimolar ratios and sequenced them at approximately 1% of a full Illumina MiSeq lane. Consensus DNA sequences have been uploaded to NCBI GenBank (KX533938-KX533939). See the electronic supplementary material for full description of methods.