The antigen used in this study was the receptor binding domain (RBD) of native (WuHan-Hu-1) SARS-CoV-2 S-protein (anti-RBD). The antigen was produced based on the previously described methodology, with modifications [21] (link). Briefly, the RBD coding sequence, flanked with the signal peptide coding sequence at 5′-end and 6xHis-Tag at 3′-end, was cloned into pCAGGS expression plasmid. Expi293F cell line (ThermoFisher Scientific), a modified HEK293 line, optimized for production of protein exported outside the cell to the cell culture medium, were transfected with expression vector using ExpiFectamine™ reagent (ThermoFisher Scientific) according to the manufacturer’s protocol. After 5 days, the cell suspension was centrifuged at 4000g, 20 min, 4 °C, and the supernatant was collected. The supernatant containing RBD protein was passed through a chromatography column filled with Ni-NTA resin (Therm Fisher Scientific), to immobilize the protein via His-tag. After immobilization, the column was washed with phosphate-buffered saline (PBS), containing 25 mM imidazole and 0.15 M NaCl. The protein was eluted from the resin using PBS containing 230 mM imidazole and 0.2 M NaCl. Subsequently, the protein solution was concentrated and purified with 10 kDa Amicon centrifugal filter columns (Merck, Germany).
Expi293f cell line
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Expi293F cell line is a human embryonic kidney (HEK) cell line derived from the HEK293 cell line. It is designed for high-level transient protein expression in suspension culture, making it a useful tool for rapid and efficient protein production in a variety of applications.
Automatically generated - may contain errors
Lab products found in correlation
Gc enhancer, by New England Biolabs (2 mentions)
Qubit fluorometric quantitation assay, by Thermo Fisher Scientific (2 mentions)
Q5 polymerase, by New England Biolabs (2 mentions)
Expi293 expression medium, by Thermo Fisher Scientific (2 mentions)
Oci aml3 cell line, by Leibniz Institute DSMZ (2 mentions)
Expifectamine reagent, by Thermo Fisher Scientific (1 mentions)
Amicon centrifugal filter columns, by Merck Group (1 mentions)
Human umbilical vein endothelial cells (huvec), by American Type Culture Collection (1 mentions)
Hek293t, by American Type Culture Collection (1 mentions)
Expifectamine transfection kit, by Thermo Fisher Scientific (1 mentions)
Hygromycin b gold, by InvivoGen (1 mentions)
Rpmi 1640 glutamax, by Thermo Fisher Scientific (1 mentions)
Ham s f12, by Harvard Bioscience (1 mentions)
Akta go system, by GE Healthcare (1 mentions)
Hek293t cell line, by American Type Culture Collection (1 mentions)
Mcf 10a cell line, by American Type Culture Collection (1 mentions)
Plasmocin, by InvivoGen (1 mentions)
Penicillin streptomycin, by Corning (1 mentions)
Dulbecco modified eagle medium (dmem), by Corning (1 mentions)
Dmem f12, by Corning (1 mentions)
10 protocols using expi293f cell line
1
Purification of SARS-CoV-2 RBD Antigen
2
Cell Line Authentication and Cultivation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T, C3H10T1/2, C2C12, and HUVEC cell lines were obtained from ATCC. Expi293F cell line was obtained from Thermo Fisher. AAV293 cell line was purchased from Agilent. The authentication of C3H10T1/2 and C2C12 cells was confirmed through cell morphology and global mRNA and protein expression analyses, such as RNA-Sequencing, qPCR, and/or western blotting, after full differentiation. HEK293T, Expi293F, and AAV293 cell lines were authenticated and routinely used in our previous studies2 (link),59 (link),60 ,62 (link). HUVEC cell line was kindly provided by Dr. Nan Xu (Henan University), and has been authenticated and successfully used in their previous study63 (link). HEK293T, C3H10T1/2, C2C12, AAV293, and HUVEC cells were cultured at 37 °C with 5% CO2, and Expi293F cells were cultured at 37 °C with 8% CO2.
3
Protein and VLP Production in Expi293F Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Expi293F cell line (ThermoFisher Scientific, Waltham, MA, USA) was used for protein and VLP production. Cells were cultured in Expi293 Expression Medium (Gibco) at 37 °C, 8% CO2, and under agitation at 125 rpm. All transfections were performed using the ExpiFectamine transfection kit (Gibco) following the manufacturer’s recommendation. Cells and supernatants were harvested 48 h after transfection.
4
Cell Line Cultivation Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The MOLM-13 and OCI-AML3 cell lines were purchased from the ‘Deutsche Sammlung von Mikroorganismen und Zellkulturen’ (DSMZ, Leibniz-Institut DSMZ, Braunschweig, Germany), the SEM cell line from the American Type Culture Collection (ATCC, Rockville, MD, USA) and the Flp-INTM-CHO cell line from Thermo Fisher Scientific (Waltham, Massachusetts, USA). MOLM-13 cells were cultured in RPMI 1640 + GlutaMAX (Gibco, Thermo Fisher Scientific) and supplemented with 20% fetal bovine serum (FBS, Gibco, Thermo Fisher Scientific). SEM and OCI-AML3 cell lines were grown in RMPI 1460 + GlutaMAX (Thermo Fisher Scientific) with 10% FBS. The Flp-INTM-CHO cell line was engineered to stably express human CD33 (CHO_CD33) or human CD47 (CHO_CD47) and maintained in selection media (Ham´s F-12 (Biochrom), 10% FBS and 550 μg/mL hygromycin B gold (InvivoGen)). The Expi293F cell line was obtained from Thermo Fisher Scientific and cultured in Expi293 Expression Medium.
5
Transcriptionally Active PCR Expression of Neutralizing Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The transcriptionally active PCR (TAP) expression of neutralizing antibodies (nAbs) was performed as previously described22 (link),25 (link). Antibodies heavy and light chain vectors were initially digested using restriction enzymes AgeI, SalI, and Xho. PCR II products were ligated using the Gibson Assembly NEB into 25 ng of respective human Igγ1, Igκ, and Igλ expression vectors45 (link),46 (link). TAP reaction was performed using 5 μl of Q5 polymerase (NEB), 5 μl of GC Enhancer (NEB), 5 μl of 5X buffer, 10 mM of dNTPs, 0.125 μl of forward/reverse primers (forward: TTAGGCACCCCAGGCTTTAC; reverse: AGATGGTTCTTTCCGCCTCA) and 3 μl of ligation product, using the following cycles: 98 °C for 2 min, 35 cycles 98 °C for 10 s, 61 °C for 20 s, 72 °C for 1 min and 72 °C for 5 min. TAP products were purified, quantified using the Qubit Fluorometric Quantitation assay (Invitrogen), and used for transient transfection in Expi293F cell line (Thermo Fisher, Cat# A14527) following the manufacturer’s instructions.
6
Expression and Purification of Anti-Neisseria gonorrhoeae Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 96 mAbs with unknown target used in this work derive from a study conducted by Fondazione Toscana Life Sciences to identify anti-N. gonorrhoeae antibodies from patients vaccinated with an anti-meningococcal vaccine22 .
Expression vectors encoding for anti-N. gonorrhoeae antibody heavy and light chains were used as templates for transcriptionally active PCR (TAP) reaction23 (link). The resulting linear DNA fragments were used for transient transfection of the Expi293F cell line (Thermo Fisher Scientific) with a heavy:light chain ratio equal to 1:2. The transfection process lasted for six days at 37 °C with 8% CO2 in shaking conditions according to the manufacturer’s protocol (Thermo Fisher Scientific, US). Cell culture supernatants were harvested six days after transfection and clarified by centrifugation (4,500 × g, 15 min, 4 °C). The reference antibody 2C7 was expressed in Expi 293 cells as well. For medium-scale mAb expression and purification, expression vectors encoding for anti-Neisseria gonorrhoeae antibody heavy and light chains were used for transient transfection of Expi293F cells in a total volume of 60 ml. Antibodies were purified by affinity chromatography on protein G columns using an AKTA-Go system (GE Healthcare Life Sciences) as described below.
Expression vectors encoding for anti-N. gonorrhoeae antibody heavy and light chains were used as templates for transcriptionally active PCR (TAP) reaction23 (link). The resulting linear DNA fragments were used for transient transfection of the Expi293F cell line (Thermo Fisher Scientific) with a heavy:light chain ratio equal to 1:2. The transfection process lasted for six days at 37 °C with 8% CO2 in shaking conditions according to the manufacturer’s protocol (Thermo Fisher Scientific, US). Cell culture supernatants were harvested six days after transfection and clarified by centrifugation (4,500 × g, 15 min, 4 °C). The reference antibody 2C7 was expressed in Expi 293 cells as well. For medium-scale mAb expression and purification, expression vectors encoding for anti-Neisseria gonorrhoeae antibody heavy and light chains were used for transient transfection of Expi293F cells in a total volume of 60 ml. Antibodies were purified by affinity chromatography on protein G columns using an AKTA-Go system (GE Healthcare Life Sciences) as described below.
7
Antibody Sequence Recovery and Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Previously obtained PCRII products16 (link),17 were used to recover the antibody heavy and light chain sequences, through Sanger sequencing, and for antibody transcriptionally active PCR (TAP) expression into recombinant IgG137 (link). TAP reaction was performed using 5 μL of Q5 polymerase (NEB), 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs, 0.125 µL of forward/reverse primers and 3 μL of ligation product, using the following cycles: 98°/2′, 35 cycles 98°/10′′, 61°/20”, 72°/1′ and 72°/5′. TAP products were purified and subsequently quantified by Qubit Fluorometric Quantitation assay (Invitrogen). Transient transfection was performed using Expi293F cell line (Thermo Fisher) following manufacturing instructions.
8
Mammalian Cell Culture Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cell line (ATCC Cat# CRL-3216, RRID:CVCL_0063): maintained in DMEM (Corning®) supplemented with 10% fetal bovine serum (Corning®), 1% Penicillin-Streptomycin (Corning®), and prophylactic Plasmocin™ (InvivoGen) at 37°C with 5% CO2 and ≥ 80% relative humidity.
Expi293F cell line (Gibco™ Cat# A14527, RRID:CVCL_D615): maintained in Expi293™ Expression Medium (Gibco™) at 37°C with 8% CO2 and ≥ 80% relative humidity and 125 rpm shaking.
MCF-10A cell line (ATCC Cat# CRL-10317, RRID:CVCL_0598): maintained in DMEM/F12 (Corning®) supplemented with 5% horse serum (Invitrogen), 20 ng/mL EGF, 0.5 μg/mL Hydrocortisone, 100 ng/mL Cholera toxin, 10 μg/mL Insulin, 1% Penicillin-Streptomycin (Corning®), and prophylactic Plasmocin™ (InvivoGen) at 37°C with 5% CO2 and ≥ 80% relative humidity.
+ Expand
HEK293T cell line (ATCC Cat# CRL-3216, RRID:CVCL_0063): maintained in DMEM (Corning®) supplemented with 10% fetal bovine serum (Corning®), 1% Penicillin-Streptomycin (Corning®), and prophylactic Plasmocin™ (InvivoGen) at 37°C with 5% CO2 and ≥ 80% relative humidity.
Expi293F cell line (Gibco™ Cat# A14527, RRID:CVCL_D615): maintained in Expi293™ Expression Medium (Gibco™) at 37°C with 8% CO2 and ≥ 80% relative humidity and 125 rpm shaking.
MCF-10A cell line (ATCC Cat# CRL-10317, RRID:CVCL_0598): maintained in DMEM/F12 (Corning®) supplemented with 5% horse serum (Invitrogen), 20 ng/mL EGF, 0.5 μg/mL Hydrocortisone, 100 ng/mL Cholera toxin, 10 μg/mL Insulin, 1% Penicillin-Streptomycin (Corning®), and prophylactic Plasmocin™ (InvivoGen) at 37°C with 5% CO2 and ≥ 80% relative humidity.
9
Cell Lines and Platelet Isolation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Expi293F™ cell line (Gibco, Grand Island, NY, US) was maintained according to the manufacturer’s recommendations. The murine pre-B cell line, BaF3, was obtained from Dr. Arthur J. Sykowski (Beth Israel Deaconess Medical Center, Boston, MA, US) and cultured in RPMI-1640 medium (Lonza, Walkersville, MD, US) supplemented with 10% fetal bovine serum (FBS) and 5% WEHI‐3B cell-conditioned medium (WEHI-CM, as a source of IL-3). BaF3 cells were stably transfected with the pCMV-human MPL plasmid (Origene, Rockville, MD, US) to establish a BaF3/MPL cell line expressing human MPL. The surface expression of human MPL was confirmed using flow cytometry with anti-CD110-APC-conjugated antibody (MiltenyiBiotec, Auburn, CA, US). The acute megakaryoblastic leukemia cell line, M07e, was purchased from the German Collection of Microorganisms and Cell Cultures (DSMZ) and grown in IMDM medium supplemented with 10% FBS and 10 ng/mL recombinant human IL-3. Normal human platelets were obtained within 1–2 days after expiration dates from the Blood Bank at Kosin University Gospel Hospital (Busan, Republic of Korea).
10
SARS-CoV-2 Spike Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RBD protein subunit from SARS-CoV-2 (isolate Wuhan-Hu-1) plasmid construct was kindly provided by Dr. Florian Krammer from Icahn School of Medicine at Mt. Sinai. Stabilized prefusion spike protein from SARS-CoV-2 (Wuhan-Hu-1) with 6 stabilizing proline mutations (HexaPro) plasmid construct was kindly provided by Dr. Jason McLellan from UT Austin (Addgene, Watertown MA, USA [53 (link)]). Both constructs were expressed in-house in Expi293F cell line (Gibco, Gaithersburg, MD, USA). Baculovirus-expressed S2 subdomain and HEK293-expressed N protein were obtained from SinoBiological (Chesterbrook, PA, USA) and RayBiotech (Peachtree Corners, PA, USA), respectively. Baculovirus-expressed S proteins from seasonal HCoVs OC43 (Chesterbrook, PA, USA) and 229E (Chesterbrook, PA, USA) were obtained from SinoBiological. In-house Expi293F-expressed hemagglutinin (HA) from egg-derived H1N1 A/California/7/2009 was used as noncoronavirus control antigen.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!