Lamp1 rfp

Manufactured by Addgene

Sourced in Germany, United States, Sweden, Norway

LAMP1-RFP is a fluorescent protein construct that is used to label the lysosome-associated membrane protein 1 (LAMP1) in live cells. LAMP1 is a glycoprotein that is primarily localized to the lysosomal membrane. The LAMP1-RFP fusion protein allows for the visualization and tracking of lysosomes within a cell.

Automatically generated - may contain errors

Lab products found in correlation

Dsred rab7, by Addgene (2 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions) Padeasy system, by Agilent Technologies (1 mentions) Dsred2 peroxisomes 4, by Addgene (1 mentions) Phusion dna polymerase, by Thermo Fisher Scientific (1 mentions) Tubacin, by Enzo Life Sciences (1 mentions) Epothilone b, by Merck Group (1 mentions) Dsred mito, by Takara Bio (1 mentions) Lamp1, by Addgene (1 mentions) Paclitaxel, by Merck Group (1 mentions) Streptavidin beads, by Thermo Fisher Scientific (1 mentions) Ammonium chloride, by Thermo Fisher Scientific (1 mentions) Pierce universal nuclease, by Thermo Fisher Scientific (1 mentions) Polyethylenimine (pei), by Polysciences (1 mentions) Dsred rab5, by Addgene (1 mentions) Pepstatin a, by Merck Group (1 mentions) Mcherry rab11, by Addgene (1 mentions) Ecl western blotting detection reagent, by Thermo Fisher Scientific (1 mentions) Protease inhibitor cocktail, by Merck Group (1 mentions) Pcmv cat t7 sb100, by Addgene (1 mentions)

Spelling variants of this product

LAMP1 (4 citations) Lamp1-RFP plasmid (2 citations)

12 protocols using lamp1 rfp

Cloning and Tagging of Cellular Organelles

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR amplification of genes of interest was performed from cDNA as previously described^{58 (link)} using Phusion DNA polymerase (Thermo Fisher). Human ACAD11 was cloned from Hep3B cell cDNA, and mouse Psmd9 was cloned from mouse liver cDNA. Amplified open-reading frames were cloned into expression vectors using Gateway Technology, restriction enzyme digest or Gibson assembly reactions (pDEST-47 GFP, C-term 3xFlag) or pAdEasy system (Agilent). Expression vectors were sequence verified and subsequently amplified and purified by midi-prep (Promega) before use in downstream protocols. Fluorescently tagged organelle constructs were purchased from AddGene (plasmid 1817: Lamp1-RFP, 54503: DsRed2-Peroxisomes-4 and 58014: mTa-gRFP-T-Endosomes-14).

Parker B.L., calkin A.C., Seldin M.M., Keating M.F., Tarling E.J., Yang P., Moody S.C., liu Y., Zerenturk E.J., Needham E.J., Miller M.L., clifford B.L., Morand P., Watt M.J., Meex R.C., Peng K.Y., lee R., Jayawardana K., Pan C., Mellett N.A., Weir J.M., lazarus R., lusis A.J., Meikle P.J., James D.E., de Aguiar Vallim T.Q, & Drew B.G. (2019). An integrative systems genetic analysis of mammalian lipid metabolism. Nature, 567(7747), 187-193.

+ Open protocol

+ Expand

Lentiviral Constructs for Tubulin Studies

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following lentiviral constructs were used in this study: EB3-GFP (62 (link)), and TTLL1-specific shRNA and control vector (Rogowski et al., 2010). TTL-ires-GFP, which was generated by cloning the coding sequence of human TTL from cDNA (GenBank BC036819) into pHAGE-CMV-ires-GFP (63 (link)). GFP-ires-GFP was used as a control plasmid. Mito-dsRed-ires-GFP, which was generated by cloning Mito-dsRed (Clontech) into pHAGE-CMV-ires-GFP. LAMP1-RFP-2A-GFP, which was generated by cloning LAMP1-RFP (Addgene #1817) into pLenti-CMV-2A-GFP (gift from C. Woolf).
Paclitaxel (Sigma), (−)-Epothilone B (Sigma) and Tubacin (Enzo Life Sciences) were kept as stocks in DMSO and were diluted in culture medium immediately prior to addition to cells. Control cultures always received an equivalent amount of DMSO.

Gornstein E.L, & Schwarz T.L. (2016). Neurotoxic mechanisms of paclitaxel are local to the distal axon and independent of transport defects. Experimental neurology, 288, 153-166.

+ Open protocol

+ Expand

Reagents and Antibodies for Cell Biology

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following reagents
and antibodies were purchased from commercial sources: Antibodies
against β-actin HRP (sc-4777), CTSL (sc-32320), GAPDH (sc-47724
HRP), normal mouse IgG (sc-2025), normal rabbit IgG (sc-2027) along
with Protein A/G PLUS-Agarose beads (sc-2003) were purchased from
Santa Cruz. Antibodies against LC3 (Cat. #12741) and Streptavidin-HRP
(Cat. #3999) were purchased from Cell Signaling Technology. Antibodies
against PSAP (A1819) and NPC2 (A5413) were purchased from Abclonal.
Protease inhibitor cocktail was purchased from Sigma-Aldrich (Cat.
P8340). Streptavidin beads, ECL Western blotting detection reagent,
and Pierce Universal nuclease were purchased from ThermoScientific.
ClarityMax Western blotting detection reagent was purchased from BioRad
(Cat. 1705062). Polyethylenimine (PEI) was purchased from Polysciences
(Cat. 4765). Inhibitors used were all purchased as follows: Bafilomycin
from CST (Cat. 54645), chloroquine diphosphate from TCI (C2301), ammonium
chloride from Fisher Scientific (A661), E64d from SeleckChem (S7393),
and Pepstatin A from Sigma (P5318). BCA assay was used for protein
concentrations. Expression plasmids for organelle markers were all
purchased from Addgene: mCherry-Sec61 (#49155), dsRed-Rab5 (#13050),
mCherry-Rab11 (#55124), dsRed-Rab7 (#12661), and Lamp1-RFP (#1817).^{40 (link)−43 (link)}

Smith M.R., Zhang L., Jin Y., Yang M., Bade A., Gillis K.D., Jana S., Bypaneni R.N., Glass T.E, & Lin H. (2023). A Turn-On Fluorescent Amino Acid Sensor Reveals Chloroquine’s Effect on Cellular Amino Acids via Inhibiting Cathepsin L. ACS Central Science, 9(5), 980-991.

+ Open protocol

+ Expand

CRISPR/Cas9 Editing of TRAC Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following expression plasmids were obtained from Addgene: tf-LC3, EGFP-LC3 (#11546), mRFP-LC3 (#21075), GFP-Rab5B (#61802), EGFP-Rab6A (#49469), GFP-Rab7 (#12605), dsRed-Rab7 (#12661), dsRed-Rab11 (12679), LAMP1-RFP (#1817), mCherry-LAMP1 (#45147), mCherry-Atg5 (#13095), mCherry-p62(#55132), EGFP-Vamp7 (#42316), pEGFP-N1, and plasmids for the Sleeping Beauty transposon system, pCMV(CAT)T7-SB100 (#34879) and pSBbiGP (#60511). Plasmids for CRISPR/Cas9-mediated editing of TRAC, including pAP368 (to express TRAC gRNA-1 and EGFP reporter gene), pAP369 (to express TRAC gRNA-2 and EGFP reporter gene), and pAP370 (to express SpCas9) were obtained from Dr. Charles Gersbach’s laboratory. sgRNAs targeting TRAC were purchased from IDT; the sgRNA sequences were: AGAGTCTCTCAGCTGGTACA (sgRNA-1) and TGTGCTAGACATGAGGTCTA (sgRNA-2). PCR primers used in sequencing TRAC were TTGCTGGGGTTTTGAAGAAG (forward) and GGTTTTGGTGGCAATGGATA (reverse).

Mao M., Chang C.C., Pickar-Oliver A., Cervia L.D., Wang L., Ji J., Liton P.B., Gersbach C.A, & Yuan F. (2020). Redirecting Vesicular Transport to Improve Non-viral Delivery of Molecular Cargo. Advanced biosystems, 4(8), e2000059.

+ Open protocol

+ Expand

Cloning and Tagging Cargo Proteins

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cDNA encoding human σ1A tagged at the C-terminus with three copies of the myc epitope (σ1A-myc) was cloned into pcDNA3.1 (Hygro+; Life Technologies, Grand Island, NY), and those encoding human σ1B or σ1C tagged at the C-terminus with three copies of the HA epitope (σ1B-HA, σ1C-HA) were cloned into pCI-neo (Promega, Madison, WI). The cDNAs encoding the full-length or cytosolic portion of wild-type and mutant cargo proteins were cloned into a modified pHis2 vector encoding MBP (Ren et al., 2013 (link)). Plasmids encoding the recombinant AP-1 core, Arf1∆1-16-Q71L (referred to as His Arf1Δ-Q71L), and VAMP4-GFP have been described previously (Tran et al., 2007 (link); Guo et al., 2013 (link); Ren et al., 2013 (link)). Lamp-1-RFP, plasmid #1817, was obtained from Addgene (submitted by W. Mothes, Yale University School of Medicine, New Haven, CT). Plasmids encoding GFP-ATP7B and TfR-mCherry were gifts from S. Lutsenko (Johns Hopkins University, Baltimore, MD) and J. Lippincott-Schwartz (National Institutes of Health, Bethesda, MD), respectively. Mutagenesis was performed using the QuikChange kit (Agilent, Santa Clara, CA).

Jain S., Farías G.G, & Bonifacino J.S. (2015). Polarized sorting of the copper transporter ATP7B in neurons mediated by recognition of a dileucine signal by AP-1. Molecular Biology of the Cell, 26(2), 218-228.

+ Open protocol

+ Expand

Plasmid Toolkit for LRRK2 and Autophagy

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmids used include EGFP-LRRK2-WT (subcloned from FLAG-LRRK2-WT, gift from W. Smith, Johns Hopkins University, Maryland), EGFP-LRRK2-G2019S (subcloned from FLAG-LRRK2-G2019S, gift from W. Smith, Johns Hopkins University, Maryland), EGFP-LRRK2-G2019S-D1994N (subcloned from FLAG-LRRK2-G2019S-D1994N, gift from W. Smith, Johns Hopkins University, Maryland), mCherry-LC3B (subcloned from EGFP-LC3, a gift from T. Yoshimori, Osaka University, Japan), PGK mCherry-LC3B (gift from Michael Ward, National Institutes of Health, Maryland), PGK EGFP-LC3B (subcloned from PGK mCherry-LC3B), mCherry-EGFP-LC3B (gift from T. Johansen, University of Tromso, Norway), EGFP-Rab29 (gift from D. Alessi, University of Dundee, United Kingdom), Halo-Rab29 (subcloned from EGFP-Rab29), EGFP-Rab5 (gift from M. Zerial, Max Planck Institute Dresden, Germany), LAMP1-RFP (Addgene #1817), EB3-mCherry (gift from A. Akhmanova, Utrecht University, the Netherlands), Halo-JIP4 (subcloned from pGEXP1-JIP4 #DU27651, acquired from MRC PPU Reagents and services, University of Dundee), SEP-LAMP1-RFP (kindly provided by J. Bonifacino, NIH, Bethesda). Unless stated otherwise plasmids used CMV promoter to initiate transcription.

Boecker C.A., Goldsmith J., Dou D., Cajka G.G, & Holzbaur E.L. (2021). Increased LRRK2 kinase activity alters neuronal autophagy by disrupting the axonal transport of autophagosomes. Current biology : CB, 31(10), 2140-2154.e6.

+ Open protocol

+ Expand

Generation and Validation of LAMP1-RFP Expressing Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

U87MG astrocytoma and SH-SY5Y neuroblastoma cells were cultured in Dulbecco’s Modified Eagle Medium (1× DMEM, Invitrogen, Waltham, MA, USA) containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin solution (Invitrogen). They were grown in T75 (75 cm² area) flasks and sub-cultured after reaching 80% to 90% confluence. Cells were passaged every 3 to 4 days using 0.025% trypsin (Invitrogen) and did not exceed 10 passages. Cells were maintained at 37 °C and 5% CO₂. A cell line stably expressing LAMP1-RFP (Addgene, Watertown, MA, USA, #1817) was generated using U87MG cells and lipofectamine 2000 (Invitrogen, Waltham, MA, USA). Media was replaced 7 h after transfection, and incubation continued for 48 h. Expression levels were confirmed using confocal microscopy.

Halcrow P.W., Kumar N., Quansah D.N., Baral A., Liang B, & Geiger J.D. (2022). Endolysosome Iron Chelation Inhibits HIV-1 Protein-Induced Endolysosome De-Acidification-Induced Increases in Mitochondrial Fragmentation, Mitophagy, and Cell Death. Cells, 11(11), 1811.

+ Open protocol

+ Expand

Plasmid Sourcing and Cloning for Organelle Imaging

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following plasmids were obtained from Addgene: mApple-TOMM20-N-10 (Addgene; 54955), mCitrine-N1 (Addgene; 54594) (27 (link)), and EBFP2-Lysosomes-20 (Addgene; 55246) were gifts from M. Davidson; LAMP1-mGFP (Addgene; 34831) (28 (link)) was a gift from E. Dell-Angelica; pmTurquoise2-N1 (Addgene; 60561) (29 (link)) was a gift from D. Gadella; Halo-KDEL (Addgene; 124316) (30 (link)) was a gift from J. Wang; pEGFP-parkin WT (Addgene; 45875) (31 (link)) and pEGFP-parkin C431S (Addgene; 45877) (31 (link)) were gifts from E. Fon; EGFP-Rab7A (Addgene; 28047) (32 (link)) was a gift from Q. Zhong; pMXs-3xHA-EGFP-OMP25 (Addgene; 83356) (24 (link)) and pLJC5-Lamp1-RFP-3xHA (Addgene; 102932) (23 (link)) were gifts from D. Sabatini; psPAX2 (Addgene; 12260) was a gift from D. Trono; Lamp1-RFP (Addgene; 1817) (33 (link)) was a gift from W. Mothes; pGEX-4T-3-mR7BD (Addgene; 79149) (34 (link)) was a gift from A. Edinger; and Halo-TOMM20-N-10 (Addgene; 123284) was a gift from K. McGowan. Additional plasmids included the following: EGFP-Rab7 K38R (a gift from P. Song) (9 (link)), pLP3 (Invitrogen; K497500), and pGEX-4T-1 (Millipore Sigma; GE28-9545-49). The following plasmids were generated for this study using standard cloning procedures: LAMP1-Halo, LAMP1-pmTurquoise2, mCitrine-TOMM20, Halo-Parkin WT, Halo-Parkin C431S, pER4-mApple-TOMM20, pER4-LAMP1-mGFP, and pER4-3xHA-EGFP-OMP25.

Peng W., Schröder L.F., Song P., Wong Y.C, & Krainc D. (2023). Parkin regulates amino acid homeostasis at mitochondria-lysosome (M/L) contact sites in Parkinson’s disease. Science Advances, 9(29), eadh3347.

+ Open protocol

+ Expand

Molecular Cloning and Genetic Engineering

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmids were constructed by molecular cloning and verified by sequencing. Site directed mutagenesis was used to introduce mutations to designed positions on GZnP1^{29 (link)}. GZnP3 was fused to Rab7a amplified from mCherry-Rab7a (Addgene #55127) and TRPML1 from TRPML1-HA (Addgene #18825)^{21 (link)}. GZnP3 was fused to LAMP1 amplified from LAMP1-RFP (Addgene #1817)^{60 (link)}. GZnP3 was fused to synaptophysin from synaptophysin-GCaMP3 (a kind gift from Dr. Susan M Voglmaier, UCSF). GZnP1, GZnP2, GZnP3, and pHuji (amplified from TfR-pHuji, Addgene #61505)^{49 (link)} were amplified and cloned into the pDisplay vector.

Minckley T.F., Zhang C., Fudge D.H., Dischler A.M., LeJeune K.D., Xu H, & Qin Y. (2019). Sub-nanomolar sensitive GZnP3 reveals TRPML1-mediated neuronal Zn2+ signals. Nature Communications, 10, 4806.

+ Open protocol

+ Expand

Visualizing Phosphoinositide Dynamics

Cited 5 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

All salts were from Sigma-Aldrich. PAO was from Sigma-Aldrich, and wortmannin and PIK93 were from TOCRIS Bioscience. The following plasmids were used: GFP-PH-OSBP (Balla et al., 2005 (link); gift from Tamas Balla, National Institutes of Health, Bethesda, MD), GFP-PHx2-OSH2 (Stefan et al., 2011 (link); plasmid 36095; Addgene), GFP-P4M-SidM (Hammond et al., 2014 (link); plasmid 51472; Addgene), mRFP-PH-PLCδ1, mRFP-PH-Akt, GFP-Sac2 (Nakatsu et al., 2015 (link); gift from Pietro DeCamilli, Yale University, New Haven, CT), GFP-Rab27a, GFP-Rab3a, NPY-GFP, NPY-mCherry, VAMP2-pHluorin (all gifts from Sebastian Barg, Uppsala University, Uppsala, Sweden), Lamp1-RFP (Sherer et al., 2003 (link); plasmid 1817; Addgene), GFP-Rab5, GFP-EEA1 (gifts from Pietro DeCamilli), CIBN-CAAX (Idevall-Hagren et al., 2012 (link)), GFP-CRY2-5ptase_OCRL (Idevall-Hagren et al., 2012 (link)), GFP-CRY2-iSH2 (Idevall-Hagren et al., 2012 (link)), R-GECO1 (Zhao et al., 2011 (link); plasmid 32444; Addgene), GFP-Lact-C2 (Yeung et al., 2008 (link); plasmid 22853; Addgene), EGFP-Rab4a (Rzomp et al., 2003 (link); plasmid 49434; Addgene), GFP-Rab10 (Huckaba et al., 2011 (link); plasmid 31737; Addgene), Granuphilin-GFP (Gálvez-Santisteban et al., 2012 (link); plasmid 40032; Addgene), and GFP-2xFYVE_EEA1 (Petiot et al., 2003 (link)).

Nguyen P.M., Gandasi N.R., Xie B., Sugahara S., Xu Y, & Idevall-Hagren O. (2019). The PI(4)P phosphatase Sac2 controls insulin granule docking and release. The Journal of Cell Biology, 218(11), 3714-3729.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!