Lenticrisprv2

CRISPR‐Cas9 technology was used to construct a stable transfection cell line. And the specific method was as follows. ATP5A‐KO and ATP5B‐KO cell lines were generated according to a previously published protocol. Briefly, gRNA targeting ATP5A, ACCAACTCGCCTACGCGTCT, and gRNA targeting ATP5B TGGCAAGACTGTACTGATCA, were cloned into the vector lentiCRISPR v2 (Addgene plasmid no. 52961). The lentiCRISPR v2 vector containing gRNA, psPAX2, and pMD2G was mixed and transfected with Lipofectamine 2000 (Thermo Fisher Scientific) into HEK293T cells. Lentiviruses were harvested for 48 h after transfection. Viral supernatant was used to infect the indicated cells with 8 µg mL⁻¹ polybrene (Sigma Aldrich). The infected cells were selected in a medium containing puromycin (Sigma Aldrich). The stable cell lines were examined by western blotting.

Guide RNA sequences for CRISPR/Cas9 were designed at CRISPR design web site (http://crispr.mit.edu/), provided by the Feng Zhang Lab. The SLC39A7 gRNA sequences were shown as follows: gRNA2:5’-CACCGCTCTCCCTCACCAGGCACTG-3’and gRNA4: 5’-CACCGAGCTGCTGAGATCAGCACTG-3’. The complementary oligonucleotides for gRNAs were annealed, and cloned into LentiCRISPRv2 (Addgene, Cambridge, MA). THP-1 cells were transfected with LentiCRISPRv2/gRNA using Lipofectamine 2000 (ThermoFisher, Waltham, MA, USA) following the manufacturer’s recommended protocol. Two days after transfection, cells were treated with 1 μg/ml of puromycin (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) for three days. After two weeks, the single cell was isolated with Flow cytometry into 96 well plates. The knockdown efficiency was evaluated with the protein expression of SLC39A7 by western blot.

The different MEF lines that were used in this work were generated as follows: MEFs were extracted from E13 embryos. Embryos were sterilized with ethanol, washed with PBS, and triturated with razor blades. Samples were then incubated in DMEM (Gibco) overnight at 37 °C and 5% CO₂. The next day, cultured cells were trypsinized, filtered and washed. Finally, MEFs were incubated at 37 °C and 5% CO₂ and used for the corresponding experiments. For CRISPR/Cas9-mediated gene targeting, MEFs and HEK293T cells were infected with the lentiviral vector LentiCRISPRv2 (Addgene repository). LentiCRISPRv2 vector was digested with BsmBI enzyme (Thermo Fisher). LentiCRISPRv2-ATG4D was generated by inserting 5′-TGGGGGTGCATGTTACGCAG-3′ and 5′-CTGCGTAACATGCACCCCCA-3′or 5′-TACGCAGCGGCCAGATGATG-3′ and 5′-CATCATCTGGCCGCTGCGTA-3′ hybridized oligonucleotides, respectively, in between BsmBI restriction sites of the LentiCRISPRv2 vector. LentiCRISPRv2-ATG4A was generated by inserting 5′-TGGGGATGTATGCTGCGcTG-3′ and 5′-CAGCGCAGCATACATCCCCA-3′ hybridized oligonucleotides, respectively, in between BsmBI restriction sites of the LentiCRISPRv2 vector. These cell lines were tested negative for mycoplasma contamination by PCR analysis.

Genes‐knockout cell lines were generated by means of CRISPR‐cas9 technology as previously reported.^[56] Single guided RNA (sgRNA) primers targeting the gene SNCG (Gene ID: 6623), and CST3 (Gene ID: 1471) were designed using the online tool (https://portals.broadinstitute.org/gpp/public/analysis‐tools/sgrna‐design).^[57] The sgRNA target sequences are listed in Table S2 (Supporting Information). Annealed primers were cloned into the plasmid LentiCRISPR v2 (gifts from Dr. Feng Zhang through Addgene, plasmid 52 961).
The constructed CRISPR lentivirus vectors were then transduced into HEK293T cells together with the packaging plasmids (pSPAX2 and pMD2.G) using Lipofectamine 2000 Transfection Reagent (Invitrogen) according to the manufacturer's protocol. The supernatant containing viruses were harvested at 48 hours after transfection and then utilized to infect cells through a 0.44 µm filter. Puromycin (1 µg mL⁻¹) was added to select the positively infected cells for 2 weeks. Then these infected cells were seeded into 96‐well plate with one cell per well. Single colonies were amplified and validated by western blot. The clones with no detectable target signal were kept for subsequent experiments.

The 20 nucleotide guide sequences targeting the mouse linx gene were designed using the CRISPR design tool (http://www.genome-engineering.org/crispr/) and cloned into a lentivirus expression vector lentiCRISPR v2 (Addgene #52961)^{23 (link)}. The guide sequences targeting the mouse linx gene were 5′-GCGCACCCCCCAGCGTGCGT-3′ (m2) and 5′-ATGTTACATTGCGTCGCCGA-3′ (m3). The single guide RNAs (sgRNAs) in the lentiCRISPR v2 vector (2.5 μg), pxPAX2 (2.5 μg) and pVSV-G (1 μg) were transfected into 293 T cells in 6-cm dishes using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Twenty-four hours post-transfection, the medium was replaced with 5 ml of fresh DMEM/10% FBS. Seventy-two hours post-transfection, the medium was collected and syringe filtered with a 0.45 µm pore size membrane (Millipore). The collected medium containing the virus was used to infect N1E-115 cells, followed by incubation for 48 hr with the addition of puromycin (1 µg/ml) for selection.

The sgRNA-coding cDNAs for targeting the FAM289 gene were designed and synthesized to make the FAM289-sgRNA-Cas9 constructs as described by Wang et al. [20 (link)]. The primers including the 20 bp target sequence and BsmBI sticky end were annealed and inserted into the lenti-CRISPRv2 plasmid (Genloci Biotechnologies, China) and digested with BsmBI (NEB, USA). The primer sequences are provided in Additional file 6: Table S1.
FAM289 lenti-CRISPRv2/Cas9 plasmid was used for gene knockdown experiments. To package lentivirus, each lenti-CRISPRv2 plasmid with other components (psPAX2,pMD2.G) were transfected into HEK293T cells using Lipofectamine™ 3000 (Invitrogen, USA). Transfected cells were cultured in DMEM containing 5% FBS, 100 U/ml penicillin and 100 μg/ml streptomycin. Culture media were replaced after 24 h with fresh growth media. Forty-eight hours later, lentiviral particles were concentrated from culture media filtrated with 0.45 μm filters by using the Lenti-X Concentrator (Clontech, USA). Aliquots were stored at − 80 °C until use. To transduce U87-MG cells, 1.0 × 10⁵ cells were plated in each well of a six-well plate, infected with the lentivirus, treated with polybrene for 24 hrsand selected by adding 3.5 μg/ml puromycin to the growth medium for 4–6 days. Lentivirus with a scrambled sequence was used as control.