Protein expression silencing was done by lentiviral shRNA. Mission shRNA (Sigma Aldrich) was co-transfected with pLKO.1-shRNA-Control or pLKO.1-shRNA-1:(CCGGCAAGTTCCACATTGGTATCAACTCGAGTTGATACCAATGTGGAATTGGTATCAACTCGAGTTGATACCAATGTGGAACTTGTTTTTTG ), together with pSMD.G and psPAX-2 (Addgene) packaging vectors (4.5 μg shRNA, 3 μg, psPAX-2, 1.5 μg psMD.G with 30 μL PolyJet DNA In Vitro Transfection Reagent) into a 10 cm plate to make virus. The medium was changed 6 h later. Forty-eight hours after transfection, the viral supernatant was collected, centrifuged at 3000 x g for 10 min and added to ~50% confluent control and HEK293A cells with 8 μg/mL polybrene (#AL-118 from Sigma Aldrich). Sixteen hours after transfection the medium was again changed and puromycin (#ant-pr-1 from Invitrogen) added to a final concentration of 5 μg/mL. Under these conditions, non-infected cells died within 24 h. shRNA used for human PKA Catα (PRKACA) from Sigma:
Polyjet dna in vitro transfection reagent
Manufactured by Addgene
The PolyJet DNA In Vitro Transfection Reagent is a laboratory product designed for the transfection of DNA into cells in vitro. It facilitates the introduction of genetic material into target cells for various research applications.
Automatically generated - may contain errors
2 protocols using polyjet dna in vitro transfection reagent
1
Silencing Protein Expression using Lentiviral shRNA
2
Silencing Protein Expression via Lentiviral shRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protein expression silencing was done by lentiviral shRNA. Mission shRNA (Sigma Aldrich) was co-transfected with pLKO.1-shRNA-Control or pLKO.1-shRNA-1: (CCGGCAATAAGCAACAGAT GATATTCTCGAGAATATCATCTGTTGCTTATTGTTTTTG), together with pSMD.G and psPAX-2 (Addgene) packaging vectors (4.5 μg shRNA, 3 μg psPAX-2, 1.5 μg psMD.G with 30 μL PolyJet DNA In Vitro Transfection Reagent) into a 10 cm plate to make virus. The medium was changed 6 h later. Forty-eight hours after transfection, the viral supernatant was collected, centrifuged at 3000 x g for 10 min and added to ~50% confluent control and HEK293A cells with 8 μg/mL polybrene (#AL-118 from Sigma Aldrich). Sixteen hours after transfection the medium was again changed and puromycin (#ant-pr-1 from Invitrogen) was added to a final concentration of 5 μg/mL. Under these conditions, non-infected cells died within 24 h. shRNA used for human AKAP13 from Sigma:
TRCN0000296007: CCGGCAATAAGCAACAGATGATATTCTCGAGAATATCATCTGTTGCTTATTGTTTTTG
TRCN0000296006: CCGGTGAGAATGCAGAACGTTTAAACTCGAGTTTAAACGTTCTGCATTCTCATTTTTG
TRCN0000037971: CCGGGCTGAAGATGATGTAGTGTTTCTCGAGAAACACTACATCATCTTCAGCTTTTTG
TRCN0000037972: CCGGGCAGTTCTTCTCACTGACATTCTCGAGAATGTCAGTGAGAAGAACTGCTTTTTG
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!