The ChIP procedure was carried out according to the manufacturer’s suggestion [Chromatin Immunoprecipitation (ChIP) Assay Kit; Millipore, Darmstadt, Germany]. The pull-down DNA was amplified for detection with either EGFR forward and reverse primers (primer sequences in the luciferase assay section) or exon 19 primers27 (link) by real-time PCR (Stratagene Mx3005P). The PCR products were finally separated on a 2% agarose gel with EZ-Vision DNA Dye (AMRESCO, USA). ChIP real-time PCR was quantified via the fold enrichment method (antibody signal over IgG secondary antibody control) to obtain ΔCt (Ct of IP Ab- Ct of IgG Ab). ΔΔCt was calculated as ΔCt (treatment; rActivin A or inhibitor treatment) – ΔCt (control or DMSO), and then the relative fold of enrichment was calculated as 2−ΔΔCt. OC3 cells were serum-starved for 24 hr before rActivin A (10 ng/ml) treatment. OC3 cells treated with DMSO alone were considered onefold, and the relative fold for each treatment was normalized to the level of the DMSO-treated OC3 group.
Ez vision dna dye
Manufactured by Avantor
Sourced in United States
EZ-Vision DNA Dye is a fluorescent dye used for the detection of DNA in agarose gels. It is designed to provide a simple and efficient way to visualize DNA during electrophoresis procedures.
Automatically generated - may contain errors
Lab products found in correlation
Cloneamp hifi pcr premix, by Takara Bio (2 mentions)
Chromatin immunoprecipitation chip assay kit, by Merck Group (1 mentions)
Gibson assembly, by New England Biolabs (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Mmlv reverse transcriptase 1st strand cdna synthesis kit, by Illumina (1 mentions)
Taq dna polymerase master mix, by Ampliqon (1 mentions)
Masterpure rna purification kit, by Illumina (1 mentions)
Abi 3500 dna analyzer, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
In fusion hd cloning plus kit, by Takara Bio (1 mentions)
T4 ligase, by Takara Bio (1 mentions)
Quikchange lightning multi site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Zymoclean gel dna recovery kit, by Zymo Research (1 mentions)
Quikchange lightning site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
9 protocols using ez vision dna dye
1
ChIP Assay for Activin A Signaling
2
Construction and Characterization of MBP-Intein-GFP Reporter in Mycobacteria
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All plasmids used in the present study are listed in Table S1 in the supplemental material, and all oligonucleotides, synthesized by Integrated DNA Technologies, are listed in Table S2 . EZ-Vision DNA dye (Amresco) was used to visualize DNA. CloneAmp HiFi PCR Premix (Clontech) was used to amplify DNA. M. smegmatis DnaBi1 was inserted in-frame using Gibson assembly (NEB) into kanR [aminoglycoside O-phosphotransferase APH(3′)-Ia; NCBI reference sequence WP_000018329.1 ] of pUC4K. An E.Z.N.A. plasmid minikit (Omega) was used to prepare plasmids. Construction of the m altose b inding p rotein (MBP)-i ntein-g reen f luorescent p rotein (GFP) (MIG) reporter for M. smegmatis and M. leprae DnaBi1 was previously described (7 (link)). Within MIG, the intein is flanked by 8 N-extein residues and 10 C-extein residues from native DnaB sequence. All clones were verified by sequencing (EtonBio).
3
SprA and SprB Recombination Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Unless otherwise noted in the Figure legends, 20 nM of the DNA substrates, 0.5 μM SprA, and 1 μM SprB were reacted at 37°C for 60 min in 10 μl of the reaction solution containing 10 mM Tris–HCl (pH 8.0), 20 mM NaCl, and 0.1 mM DTT. The recombination reaction was stopped by the addition of 0.1% SDS and by heat treatment at 60°C for 3 min. Reaction products were separated by agarose gel electrophoresis. Signals were detected using EZ-Vision DNA Dye (AMRESCO, OH, USA).
4
RNA Isolation and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol (Invitrogen) as described by Tóth et al. 2011 30 , and the isolated total RNA was reverse‐transcribed into cDNA and then amplified on a GeneAmp PCR System 2400 DNA Thermal Cycler (Applied Biosystems, Foster City, CA, USA). Primers were synthesized by Integrated DNA Technologies (Leuven, Belgium) (TRPC6, forward: 5′‐TCAATCTGGTGCCGAGTCCAAAGT‐3′, reverse: 5′‐TTTATGGCCCTGGAACAGCTCAGA‐3′, 86 bp; glyceraldehyde‐3‐phosphate dehydrogenase, forward: 5′‐AATGAGCCCCAGCCTTCTCCAT‐3′, reverse: 5′‐AAGGTCGGAGTCAACGGATTTGG‐3′, 322 bp). PCR products were visualized on 1.5% agarose gel with EZ‐Vision DNA Dye (Amresco, Solon, OH, USA) under UV.
5
Gene Expression Analysis by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were treated with Honokiol or Temozolomide for 48 h, the total cellular RNA were isolated using MasterPure RNA Purification Kit (Epicentre Biotechnologies, Madison, WI, USA) according to the manufacture’s protocols, and then quantified by an absorbance at 260 nm. RNA purity was determined using A260/A280 ratio (average ≥ 1.8). Total RNA from each specimen was first reverse-transcribed into cDNA using a MMLV Reverse Transcriptase 1st-Strand cDNA Synthesis Kit (Epicentre Biotechnologies), and then the target genes were amplified using Taq DNA Polymerase Master Mix (Ampliqon, Lars Quist, Denmark). Specimens were subjected to 30 cycles of amplification (cDNA synthesis at 37°C for 1 h followed by pre-denaturation at 94–C for 2 min, and the PCR amplification was performed with denaturation at 94 C for 30 sec, annealing at 58–60°C for 30 sec, extension at 72°C for 1 min, and the final extension at 72°C for 10 min). PCR products were mixed with EZ-Vision DNA Dye (Amresco, Solon, OH, USA) and then electrophoresed on a 1.8% agarose gel, finally visualized by UV-Visible Transilluminators System. The data were then quantified with Image J software.
6
Chromosomal DNA Extraction and Sequence Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromosomal DNA was extracted from the B. cereus vegetative and sporulating cells, according to the method described previously11 (link). The junction sequences at the attB (composite gerE) and attG (the excised gin element) sites were amplified from 100 ng of the chromosomal DNA with the primer sets PA246/PA249 and PA247/PA248, respectively. PCR products were separated by agarose gel electrophoresis, and stained using EZ-Vision DNA Dye (AMRESCO, OH, USA). Gel images were cropped, using Paintgraphic2 (SOURCENEXT, Tokyo, Japan). DNA sequencing was performed, using an ABI 3500 DNA analyzer (Thermo Fisher Scientific, WI, USA) with the PA246 (for the 5′- and composite gerE) or PA248 (for 3′-gerE and the excised gin element) primers and the BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific).
7
Construction and Verification of Bacterial Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All plasmids used in the present study can be found in Supplementary Table 2 and all oligonucleotides, synthesized by Integrated DNA Technologies (IDT), are in Supplementary Table 3 . Plasmid DNA was prepared using E.Z.N.A. Plasmid Mini Kit (Omega). DNA was visualized in 1% agarose gels using EZ-Vision DNA Dye (Amresco). PCR fragments were amplified using CloneAmp HiFi PCR Premix (Clontech) from Msm mc2 155, Mtu H37Rv, or Mle Br 4923 genomic DNA (BEI Resources). Digest and PCR fragments were gel purified using Zymoclean Gel DNA Recovery Kit (Zymo Research). Restriction enzymes (NEB), T4 ligase (NEB), and In-Fusion HD Cloning Plus Kit (Clontech) were all used per manufacturer protocol. Mutagenesis was performed using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) for single amino acid mutations or QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) for multiple amino acid mutations. All clones were verified by sequencing (EtonBio).
8
HLA Amplification from Raw Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 1
Tandem PCR Yields Constant 2° Product Over Wide 1° Input Amounts
2 μl of raw blood was used as the template for the primary, locus-specific HLA PCR reactions required for HLA-Chip analysis. Amplification was performed via the Finnzymes PHUSION® Blood Direct kit. Different amounts of that primary, locus specific PCR product were then diluted in H2O and used as template for the secondary, self limiting, exon-specific PCR reactions. One microliter of each of the resulting 2° PCR reaction product was then loaded onto a standard acrylamide gel. HLA-A exons 2 and 3 and HLA-DRB1 exon 2 (
9
PCR Detection of H. perezi DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Methods used to extract and detect H. perezi DNA by PCR were as described previously (Gruebl et al. 2002 , Small et al. 2007 , Pagenkopp Lohan et al. 2012) (link). Briefly, 200 µl ethanol-preserved hemolymph was centrifuged to remove excess etha nol. Pelleted hemocytes were lysed overnight and extracted using a DNeasy Blood and Tissue Kit (QIAGEN) according to the manufacturer's protocol. DNA was eluted from columns using 2 × 5 min elution incubations with 100 µl elution buffer. PCR primer pairs used were (1) general metazoan primers nSSU-A and nSSU-B, (2) Hematodinium sp. primers HITS1F and HITS1R, and (3) Hematodinium spp. primers Hemat-F-1487 and Hemat-R-1654.
Reaction mixtures and thermocycling conditions described previously were modified slightly (Rogers et al. 2015) (link). Briefly, reactions (10 µl) included a negative (no template) control and a positive control of DNA extracted from ethanol-preserved hemolymph of a known infected crab provided kindly by Dr. Jeffrey Shields, Virginia Institute of Marine Science. Positive and negative controls were extracted using the same method used for samples. Amplified DNA products were stained with EZ-Vision DNA Dye (Amresco), separated by 2% agarose gel electrophoresis, and visualized under UV light. If a sample did not amplify using the general metazoan primers
Reaction mixtures and thermocycling conditions described previously were modified slightly (Rogers et al. 2015) (link). Briefly, reactions (10 µl) included a negative (no template) control and a positive control of DNA extracted from ethanol-preserved hemolymph of a known infected crab provided kindly by Dr. Jeffrey Shields, Virginia Institute of Marine Science. Positive and negative controls were extracted using the same method used for samples. Amplified DNA products were stained with EZ-Vision DNA Dye (Amresco), separated by 2% agarose gel electrophoresis, and visualized under UV light. If a sample did not amplify using the general metazoan primers
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!