Total RNA was extracted from the cultured cells or lung tissues using TRizol reagent (no. R401-01, Vazyme) according to the manufacturer's instructions. The sequences of primer pairs used in this assay are shown in Table S2 . qRT-PCR was performed using the SYBR Green qRT-PCR kit (no. Q111-02, Vazyme) on an ABI ViiA 7 Real-Time PCR System (Applied Biosystems, Waltham, MA). The Ct values were analyzed using the ΔΔCt method, and the relative quantification of the expression of the target genes was measured using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA as an internal control.
Sybr green qrt pcr kit
Manufactured by Vazyme
Sourced in China
The SYBR Green qRT-PCR kit is a reagent kit designed for quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) analysis. The kit contains all the necessary components, including SYBR Green I dye, for the detection and quantification of RNA targets.
Automatically generated - may contain errors
Lab products found in correlation
First strand cdna synthesis kit, by Toyobo (3 mentions)
Hipure plant rna mini kit, by Magen Biotechnology Co (3 mentions)
Abi viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Vazyme (1 mentions)
Quantstudio 6 flex system, by Thermo Fisher Scientific (1 mentions)
Abi 7900ht sequence detection system, by Thermo Fisher Scientific (1 mentions)
Trizol plus rna purification kit, by Thermo Fisher Scientific (1 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
6 protocols using sybr green qrt pcr kit
1
Quantitative Real-Time PCR Analysis of Gene Expression
2
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissue samples using the HiPure Plant RNA Mini Kit (Magen, Guangzhou, China) following the manufacturer’s instructions and stored at −80 °C until use. A First Strand cDNA Synthesis Kit (Toyobo, Kita-ku, Osaka, Japan) with random primers was used to synthesize first-strand cDNA, and 1 µg total RNA was added per 20 µL reaction volume. Quantitative PCR was carried out using the SYBR Green qRT-PCR kit (Vazyme, Nanjing, China) on an ABI 7900HT sequence detection system (Applied Biosystems QuantStudio 5, Foster City, CA, USA) to detect the relative expression levels of the genes. At least three biological replicates and three technical replicates were used for all qPCR analyses. Each experiment was repeated at least three times. Relative expressions of the assayed genes were calculated using the 2−ΔΔCt method. The primers used in this study are listed in Table S8 .
3
Transcriptional Profiling of Plant Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from N. benthamiana or wheat tissue samples using the HiPure plant RNA mini kit (Magen, Guangzhou, China). First-strand cDNAs were synthesized using random primers, 1 μg total RNA per 20 μL reaction, and the First Strand cDNA Synthesis Kit (TOYOBO, Osaka, Japan). Quantitative PCR was carried out using the SYBR Green qRT-PCR kit (Vazyme, Nanjing, China) on an Applied Biosystems QuantStudio 6 Flex system (Applied Biosystems, Foster City, CA, USA). Relative expressions of the assayed genes were calculated using the 2-ΔΔCt method. Each treatment has three biological replicates with three technical replicates each. Each experiment was repeated three times. The primers used in this study are listed in the S3 Table .
4
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissue samples using the HiPure plant RNA mini kit (Magen, Guangzhou, China). Frist‐strand cDNA was synthesized with the First‐Strand cDNA Synthesis Kit (TOYOBO, Osaka, Japan) according to the manufacturer's protocol. Quantitative PCR was performed using the SYBR Green qRT‐PCR kit (Vazyme, Nanjing, China) on an ABI7900HT sequence detection system (Applied Biosystems, Foster City, CA, USA). At least three biological replicates were used for each treatment and each biological replicate has three technical replicates. The relative expression levels of assayed genes were calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001 (link)). All primers for RT‐PCR are listed in Table S3 .
5
RNA Analysis of Nanoparticle-Treated Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specifically, RAW 264.7 cells were pretreated with 20 ng mL−1 of mouse recombinant IL-4 for 24 h and cultured with HA@Fe3O4, HA@Fe3O4-O2, HA-man@Fe3O4, and ferumoxytol at 200 μg mL−1 in Fe. We extracted the total RNA of these samples with TRIzol™ Plus RNA Purification kit (Invitrogen, Carlsbad, CA, USA) based on the manufacturer’s instructions. We analyzed the RNA samples using the HiScript II One Step quantitative reverse transcription polymerase chain reaction (qRT-PCR) SYBR Green kit (Vazyme, Nanjing, China). Table S1 outlines the sequences of RT-qPCR primers.
6
qRT-PCR Analysis of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR was performed as previously described. Briefly, the purified 100ng total RNA was reverse transcribed into cDNAs using the TaqMan™ MicroRNA Reverse Transcription Kit (Invitrogen, Carlsbad, CA, USA) and qRT-PCR was performed using qRT-PCR SYBR Green Kit (Vazyme Biotech, NJ, China) according to the manufacturer’s instructions. The relative gene expression levels of miRNAs were evaluated using U6 as the endogenous normalization control. The primer of U6, forward, 5′- CTCGCTTCGGCAGCACA-3′, reverse, 5′-AACGCTTCACGAATTTGCGT-3′. The primer sequences used for the evaluated genes are listed in Table 2 . All tests were performed in triplicates.
qRT-PCR primers of chosen miRNAs
| Primers | Sequences |
|---|---|
| hsa-miR-4477a | ATTAAGGACATTTGTGATTCCTCAA |
| hsa-miR-3689e | ATATCATGGTTCCTGGGACTCA |
| hsa-miR-544a | TCTGCATTTTTAGCAAGTTCCTC |
| hsa-miR-4291 | AGCAGGAACAGCTCTCAACTGA |
| hsa-miR-1825 | CCTCCTCTCCCTCAACTGAATT |
| hsa-miR-1245b-3p | GTTGTCAGATGATCTAAAGGCCTAT |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!