The following plasmids were utilized: pMSCV-IRES GFP9 (link), pMXs-IRES-Puro (Cell Biolabs Inc), pMSCV-IRES-mCherry FP (a gift from Dario Vignali, Addgene #52114), pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE (a gift from Hans Clevers, Addgene #32702). The CSF3RT618I mutation was generated previously9 (link). Full-length CEBPA and JAK3 cDNA was obtained from Genecopia. The CEBPA and JAK3 mutations were generated using the Quikchange Site Directed Mutagenesis Kit (Agilent) using the primers in Supplementary Table 1 . To produce retrovirus, 293T17 cells were transfected with EcoPac helper plasmid (a gift from Dr. Rick Van Etten) and the appropriate transfer plasmid. Conditioned media was harvested 48–72 h after transduction.
Pmxs ires puro
Manufactured by Cell Biolabs
Sourced in United States
The PMXs-IRES-Puro is a retroviral expression vector that allows for bicistronic expression of a gene of interest and the puromycin resistance gene. The internal ribosome entry site (IRES) permits translation of the puromycin resistance gene from the same mRNA as the gene of interest, enabling selection of transduced cells.
Automatically generated - may contain errors
Lab products found in correlation
Nigericin, by New England Biolabs (2 mentions)
Phos tag sds page, by Fujifilm (2 mentions)
Puromycin, by InvivoGen (2 mentions)
Gateway lr clonase kit, by Thermo Fisher Scientific (2 mentions)
Sanger sequencing, by Eurofins (2 mentions)
Quikchange 2 xl site directed mutagenesis kit, by Agilent Technologies (2 mentions)
Pmscv ires mcherry fp, by Addgene (1 mentions)
Pmscv loxp dsred loxp egfp puro wpre, by Addgene (1 mentions)
Quikchange site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
Polyethylenimine max, by Polysciences (1 mentions)
Polybrene, by Merck Group (1 mentions)
Puromycin containing medium, by Merck Group (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Pcdna3, by Thermo Fisher Scientific (1 mentions)
Rtv 014, by Cell Biolabs (1 mentions)
Plat gp, by Cell Biolabs (1 mentions)
Rv 103, by Cell Biolabs (1 mentions)
8 protocols using pmxs ires puro
1
Retroviral Plasmid Construction and Transduction
2
Generating Stable Cell Lines with Fluorescent and Tagged Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HCT116 cells were transduced with retroviral vector encoding E2‐Crimson, Flag vector, Flag‐DYRK2‐WT, or Flag‐DYRK2‐KR. Flag and Flag‐tagged DYRK2‐WT or KR were constructed as previously described.19 , 20 Briefly, E2‐Crimson cDNA was amplified from the pE2‐Crimson‐N1 vector (Clontech, Mountain View, CA, USA) and inserted into the retroviral vector (pMXs‐IRES‐Puro; Cell Biolabs, San Diego, CA, USA). Flag vector, Flag‐DYRK2‐WT, and Flag‐DYRK2‐KR were subcloned into the retroviral vector (pMXs‐IRES‐Hyg; Cell Biolabs). They were introduced into PlatA cells using polyethylenimine‐MAX (Polysciences, Warrington, PA, USA) and OptiMEM (Invitrogen, Carlsbad, CA, USA). After 48 h, virus‐containing supernatants were passed through a 0.45‐μm filter and supplemented with 10 μg/mL polybrene (Sigma, San Francisco, CA, USA). On day 2 after infection, puromycin (40 μg/mL) or hygromycin (400 μg/mL) was added to the cultures for selection.
3
Investigating NEK7 Activation in Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
J774A.1 cells were infected with retroviruses encoding mouse NEK7, NEK7K64M and empty vector (pMXs-IRES-Puro, Cell Biolabs). 48 h after the infection, the cells were selected and cultured with 2 μg/ml puromycin (InvivoGen).
LPS-primed J774A.1 cells were treated with colchicine (10 μM), nocodazole (10 μM), cytochalasin D (5 μM) or ciliobrevin D (10 μM) for 2 h, followed by nigericin stimulation for 1 h. LPS-primed J774A.1 cells were treated with ATP and NAC for 1 h. For calf intestinal alkaline phosphatase (CIP) treatment, 100 mg cell lysate was incubated with 50 units of CIP (New England Biolabs) at 37°C for 1 h. Immunoprecipitation was performed as described above. For CIP treatment, the immunoprecipitated complex was further incubated with 50 units of CIP for 1 h at 37°C in a 50 μl reaction. Immunoprecipitates were separated by standard SDS-PAGE, or by Phos-tag SDS-PAGE (Wako Chemicals) to separate phosphorylated proteins according to their degree of phosphorylation.
LPS-primed J774A.1 cells were treated with colchicine (10 μM), nocodazole (10 μM), cytochalasin D (5 μM) or ciliobrevin D (10 μM) for 2 h, followed by nigericin stimulation for 1 h. LPS-primed J774A.1 cells were treated with ATP and NAC for 1 h. For calf intestinal alkaline phosphatase (CIP) treatment, 100 mg cell lysate was incubated with 50 units of CIP (New England Biolabs) at 37°C for 1 h. Immunoprecipitation was performed as described above. For CIP treatment, the immunoprecipitated complex was further incubated with 50 units of CIP for 1 h at 37°C in a 50 μl reaction. Immunoprecipitates were separated by standard SDS-PAGE, or by Phos-tag SDS-PAGE (Wako Chemicals) to separate phosphorylated proteins according to their degree of phosphorylation.
4
Investigating NEK7 Activation in Macrophages
5
Cloning and Transduction of HA-tagged IRX2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
IRX2 coding sequence was amplified (forward-primer: CCGCTGCTCGGCGTGACGCG, reverse-primer: TAGGTAGGGCTGGACGCCC) from cDNA obtained from the breast cancer cell line MCF-7 and cloned into the expression plasmid phCMV3 (Genlantis) using EcoRI and KpNI restrictions sites. HA-tagged IRX2 cDNA sequence was reamplified and cloned into the retroviral expression plasmid pMXs-IRES-Puro (Cell Biolabs) using EcoRI and NotI restrictions sites and afterwards the cloned cDNA sequence was verified by sequencing. For production of retroviral particles ψNX-ampho cells were transfected with the retroviral expression plasmid using Lipofectamine 2000 (Invitrogen) according to manufacturer’s suggested protocol. Viral transduction was done with 500 μl viral supernatant added to 50 % confluent recipient cultures in 6-well plates containing 1 ml cell culture medium. Positive selection was achieved 24 h after transduction using puromycin-containing medium (2 μg/ml, Sigma-Aldrich). Cells were subsequently kept under puromycin for 4 days.
6
Gateway Cloning and Site-Directed Mutagenesis
7
Mutagenesis of TNK2 Protein Variants
8
SARS-CoV-2 Pseudovirus Neutralization Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pseudoviruses were produced by co-transfection of plasmids encoding a luciferase reporter in retrovirus vector (pMXs-ires-Puro, Cell Biolabs #RTV-014) and S protein (D614G, d19) into Plat-GP (Cell Biolabs #RV-103). Serum samples were mixed with pseudoviruses, incubated, and then added to ACE2 and TMPRSS2-expressing HEK293T cells (GeneCopoeia #SL222). After 48 h, cells were lysed, and luciferase activity (RLU) was measured. The infection rate was normalized, considering uninfected cells as 0% and cells infected with only pseudovirus as 100%. ID50 titers were determined using an inhibitor versus normalized response (variable slope) nonlinear function.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!