3.0 mm beads

Normal (n=4) and ADPKD (n=5) human male kidney tissue samples were dissected from nephrectomized human kidneys received from the Baltimore PKD Research and Clinical Core Center and stored after flash freezing at −80°C (reviewed by the UMB IRB and determined to not be human research, requiring no further IRB review). Kidney tissue was homogenized using a BeadBug™6 homogenizer (Benchtop Scientific) with 3.0 mm beads (Benchmark Scientific, #D1032-30) in deoxycholic RIPA lysis buffer. Immunoblotting and development of human sample blots was performed as detailed above for tubuloid samples using a primary antibody against tensin-1 (1:100; Invitrogen, PA557515).

Whole kidney (or intestine or liver) preserved in RNAlater^TM (Qiagen, #1017980) was homogenized by bead beating using a BeadBug^TM6 (Benchtop Scientific) using 3.0 mm beads (Benchmark Scientific, #D1032-30). RNA was isolated using TRIzol^TM (Ambion, #15596026) using Phase Lock Gel Heavy tubes (Quantabio, #2302830) for phase separation followed by RNA clean up using the RNeasy® Mini Plus kit (Qiagen, #74134). 5 µg of RNA was then transcribed into cDNA using the SuperScript^TM III First-Strand Synthesis System (Invitrogen, #18080051). 10 ng of the resulting cDNA was used as template for qRT-PCR using PowerUp^TM SYBR^TM Green Master Mix (Applied Biosystems, #A25742), run using the QuantStudio 3 Real Time PCR System (Applied Biosystems). Manufacturer’s specifications were followed for all reagents listed above. Primers were validated previously^{51 (link)–57 (link)} and used the following sequences: (ABCG2: F-AAACTTGCTCGGGAACCCTC, R-CTCCAGCTCTATTTTGCATTCC,; GAPDH: F-CTTTGGCATTGTGGAAGGGC, R-TGCAGGGATGATGTTCTGGG; Fasn: F-GCTGCGGAAACTTCAGGAAAT, R–AGAGACGTGTCACTCCTGGACTT; PNPLA2: F-TATCCGGTGGATGAAAGAGC, R-CAGTTCCACCTGCTCAGACA; G6PD: F-CCGGAAACTGGCTGTGCGCT, R–CCAGGTCACCCGATGCACCC, PNPLA3: F-CGAGGCGAGCGGTACGT, R–TGACACCGTGATGGTGGTTT; SREBP-1a: F-GCGCCATGGACGAGCTG, R–TTGGCACCTGGGCTGCT; SREBP-1c: F-GGAGCCATGGATTGCACATT, AGGAAGGCTTCCAGAGAGGA).