Two different pairs of STAT3 or survivin-specific siRNA oligonucleotides and control siRNA oligonucleotides were designed and purchased from GenePharma (Shanghai, China). The sequence of STAT3 or survivin siRNAs used in this study was as follows: STAT3 siRNA-1 sense 5′-CACCGCAUCUCUACAUUCATT-3′ and antisense 5′-UGAAUGUAGAGAUGCGGUGTT-3′ STAT3 siRNA-2 sense 5′-CUGAGAACGAGCCAGACUUTT-3′ and antisense 5′-AAGUCUGGCUCGUUCUCAGTT-3′ survivin siRNA-1 sense 5′-GGGACCUGGUGUGAAUUAUTT-3′ and antisense 5′-AUAAUUCACACCAGGUCCCTT-3′ survivin siRNA-2 sense 5′-CCCGGAAAUUUAACAUUCUTT-3′ and antisense 5′-AGAAUGUUAAAUUUCCGGGTT-3′ Control siRNA sense 5′-GCACCACUUCCAGGGUUUATT-3′ and antisense 5′-UAAACCCUGGAAGUGGUGCTT-3′. Specific siRNA oligonucleotides for human DAB2IP and control siRNA were previously described.15 (link) Survivin cDNA and constitutely active STAT3C plasmids were kindly provided by Dr Allen Gao (University of California at Davis, Sacramento, CA, USA).35 (link) Transfections were performed using Lipofectamine RNAiMax (Invitrogen) according to the manufacturer's protocol.
Control sirna oligonucleotides
Manufactured by GenePharma
Sourced in China
Control siRNA oligonucleotides are synthetic, double-stranded RNA molecules designed to serve as a reference or control in RNA interference (RNAi) experiments. The core function of these oligonucleotides is to provide a baseline for comparison, allowing researchers to evaluate the effects of target-specific siRNA molecules in their experiments.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions)
Polybrene, by Merck Group (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Mir 199a 3p mimic, by GenePharma (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Turbofect in vitro transfection reagent, by Thermo Fisher Scientific (1 mentions)
4 protocols using control sirna oligonucleotides
1
Knockdown of STAT3 and Survivin in Cancer Cells
2
Silencing IQGAP3 in A549 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small interfering RNA oligonucleotides (oligos) against IQGAP3 or control siRNA oligonucleotides were obtained from GenePharma Co., Ltd (Shanghai, China). The targeting sequences of these siRNAs were as follows: si IQGAP3-1∶5′- GAGCCAACCAGGACACUAA-3′; si IQGAP3-2∶5′- GGCAGAAACUAGAAGCAUA-3′; control siRNA:5′- UUCUCCGAACGUGUCACGU-3′. siRNA oligos(50 nM)were transfected into A549 cells with jetPRIME transfection reagent.
Alternatively, the siRNA target sequence was cloned into the lentiviral vector pLL3.7. Upon sequence verification, the shRNA plasmid and packaging vectors psPAX2 and pLP/VSVG were transfected into the packaging cell line HEK293T using jetPRIME. The medium was changed 8 h post-transfection. 48 hours later, viral supernatant was harvested and incubated with the A549 cell line in the presence of 8 µg/ml polybrene (Sigma-Aldrich, Saint Louis, MO, USA). For stably transfected cell line selection, GFP fluorescence was used as a sorting marker. Cells with >75% infection efficiency were used for further analysis.
Alternatively, the siRNA target sequence was cloned into the lentiviral vector pLL3.7. Upon sequence verification, the shRNA plasmid and packaging vectors psPAX2 and pLP/VSVG were transfected into the packaging cell line HEK293T using jetPRIME. The medium was changed 8 h post-transfection. 48 hours later, viral supernatant was harvested and incubated with the A549 cell line in the presence of 8 µg/ml polybrene (Sigma-Aldrich, Saint Louis, MO, USA). For stably transfected cell line selection, GFP fluorescence was used as a sorting marker. Cells with >75% infection efficiency were used for further analysis.
3
AMPK Knockdown in BV2 Microglia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BV2 microglia were transfected with either AMPKα2 siRNA oligonucleotides (5′ GAGAAGCAGAAGCACGACGTT 3′) or control siRNA oligonucleotides (5′ UUCUCCGAACGUGUCACGUTT 3′) (GenePharma, Shanghai, China), when the cells were approximately 50% confluent. Lipofectamine 2000 (Invitrogen, Carlsbad, CA, United States) was used for the transfection according to the manufacturer’s instructions. For each well of a 24-well plate, 100 μl Opti-MEM containing 0.06 nmol of the siRNA oligonucleotides and 2 μl Lipofectamine 2000 was added into 500 μl culture media of the cells. The AMPK protein level was determined by Western Blot 18 h after the transfection.
4
Regulation of Ntera-2 Cells by miR-199a-3p and Sp1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell culture and transient transfection. Human testicular teratoma Ntera-2 (CRL-1973 cells, American Type Culture Collection, Manassas, VA, USA) were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin and 100 mg/ml streptomycin at 37˚C with 5% CO 2 and 95% humidity. cell transfection was performed using TurboFect TM in vitro Transfection reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. For the rescue experiments, Ntera-2 cells were transfected with pcdNA3.1-Sp1 or pcDNA3.1 empty plasmids (Vigene Biosciences, Ji'nan, Shandong, China) with miR-199a-3p mimics (100 nM; Table I; Shanghai GenePharma Co., Ltd., Shanghai, China) and cultured for 72 h to investigate whether Sp1 overexpression rescued the metabolic phenotype of Ntera-2 cells.
For the RNA interference (RNAi)-mediated inhibition of Sp1 expression, Ntera-2 cells were transfected with 3 kinds of Sp1 small interfering RNA (siRNA) oligonucleotides or control siRNA oligonucleotides (Table I; Shanghai GenePharma Co., Ltd.) and cultured for 72 h before subsequent experimentation.
For the RNA interference (RNAi)-mediated inhibition of Sp1 expression, Ntera-2 cells were transfected with 3 kinds of Sp1 small interfering RNA (siRNA) oligonucleotides or control siRNA oligonucleotides (Table I; Shanghai GenePharma Co., Ltd.) and cultured for 72 h before subsequent experimentation.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!