Rna extraction kit

Total RNA was extracted from testicular tissues using an RNA extraction kit (Sparkjade Biotechnology Co., LTD, Shandong, China). Then, 2 μg of RNA was reverse transcribed using HiScript Ⅱ1 s Strand cDNA Synthesis Kit (+gDNA wiper) obtained from Vazyme Biotech Co., Ltd. Briefly, 2 μg of total RNA was used to make the first strand of complementary DNA (cDNA; in 20 μL) using an RT2 First Strand Kit (Cat. No: AT311-03, Transgen Biotech, Beijing, China) following the manufacturer’s instructions. The generated first-strand cDNAs (20 μL) were diluted to 150 μL with double-deionized water (ddH₂O). Then, 1 μL was used for one PCR reaction (in a 96-well plate). Each PCR reaction (12 μL) contained 6 μL of qPCR Master Mix (Roche, Basel, Switzerland), 1 μL of diluted first strand cDNA, 0.6 μL primers (10 mM), and 4.4 μL of ddH2O. The primers for qPCR analysis were synthesized by Tsingke. qPCR was conducted by using a Roche LightCycler 480 (Roche, Basel, Switzerland) with the following program: step 1: 95 °C, 10 min; step 2: 40 cycles of 95 °C, 15 s; 60 °C, 1 min; step 3: dissociation curve; step 4: cool down; n = 3/group. Additionally, the relative abundance of mRNA was calculated and normalized to mean β-actin mRNA levels. The primer sequences used in this study are presented in Table 1.

The total RNA was isolated from exosomes with an RNA extraction kit (Sparkjade, Jinan, China) according to the manufacturer’s protocol. A NanoDrop2000 (Thermo) was used to measure the concentration and purity of the isolated RNA. These RNAs were then reverse-transcribed into cDNA by an RT kit (Sparkjade, Jinan, China). Quantitative real-time PCR was conducted using a Roche Light Cycler 480 real-time PCR system with a SYBR Green qPCR kit (Sparkjade, Jinan, China). Each sample was analyzed in triplicate, and the fold changes were calculated using the 2^−(ΔΔCt) cycle threshold method. The sequences of the primers are shown in Table 1 [31 (link)].Table 1.

Specific primers used for quantitative qRT-PCR

Gene name	Forward primer sequence (5ʹ-3ʹ)	Reverse primer sequence (5ʹ-3ʹ)
chr15:26,003,835–26,004,050-	CAGGTGGTCGGAATGAGG	CCACCTGCTCCACCCTTA
GAPDH	GGCCTCCAAGGAGTAAGACC	AGGGGAGATTCAGTGTGGTG

Total RNA was extracted from HepG2 cells using RNA extraction kit (Sparkjade, Shandong, China), and RNA purity was detected using Nanodrop 2000c (Thermo Fisher Scientific, Waltham, MA, United States). Total RNA was reverse transcribed to cDNA using reverse transcription kit (Sparkjade, Shandong, China). Quantitative polymerase chain reactions (qPCR) were performed with SYBR Green I Kit (Sparkjade, Shandong, China) in the RT-qPCR Detection System LC480 (Roche, Mannheim, Germany) for a total of 40 cycles (94°C for 20 s, 60°C for 20 s, 72°C for 30 s). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference gene, and mRNA expression levels were calculated using the 2^−ΔΔCT method. The sequences of specific primers are listed in Table 1.