For the generation of stable cell lines, 2 μg of pCMV6-RIP140-GFP vectors (Origene, Rockville, MD, USA) were transfected into 2 × 105 undifferentiated N2a cells using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA). Controls were transfected with empty vector (Origene). In parallel, cells were plated and mock-transfected in the absence of DNA. 48 hour after transfection, transfected cells were selected by treating with puromycin (2 μg/ml) or G418 (500 μg/ml). Cells remained under antibiotic selection, and by 15−20 days (with fresh media and antibiotic replenishment every 48 hours), the mock-transfected cells all died. Individual clones were then selected to be identified by real-time quantitative polymerase chain reaction (RT-qPCR) and western blotting.
Empty vector
Manufactured by OriGene
Sourced in United States
An empty vector is a circular DNA molecule used as a backbone for cloning and expressing foreign genes. It provides the necessary elements for DNA propagation and selection in host organisms, such as bacterial cells. The core function of an empty vector is to serve as a basic framework for the insertion and manipulation of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (3 mentions)
Hyaluronidase type 1 s, by Merck Group (2 mentions)
Saa3 3 utr reporter plasmid, by GeneCopoeia (2 mentions)
Wt regnase 1 expression vector, by OriGene (2 mentions)
Dual luciferase assay system, by Promega (2 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000, by OriGene (1 mentions)
Puromycin, by Merck Group (1 mentions)
Lipofectamine, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000, by Merck Group (1 mentions)
Jetprime transfection reagent, by Polyplus Transfection (1 mentions)
Interleukin 4 (il 4), by Thermo Fisher Scientific (1 mentions)
Il 13, by Thermo Fisher Scientific (1 mentions)
Thp 1 cell, by American Type Culture Collection (1 mentions)
Mgc 803, by American Type Culture Collection (1 mentions)
Bgc 823, by American Type Culture Collection (1 mentions)
Pcdna3.1 zeo, by Thermo Fisher Scientific (1 mentions)
Control shrna, by OriGene (1 mentions)
Sictrl, by Horizon Discovery (1 mentions)
Pgfp 5 rs, by OriGene (1 mentions)
10 protocols using empty vector
1
Establishing Stable Cell Lines with RIP140
2
Generating Sox9 Knockdown and Overexpression Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To establish Sox9 knockdown clones, recombinant lentivirus was generated by co-transfecting 293FT cells with shSox9 from Sigma-Aldrich Mission® shRNA bacterial glycerol stock, Clone IDs: TRCN0000020386 (shSox9#386) and TRCN0000020388 (shSox9#388) or non-target control (NTC) plasmids and packaging plasmid mix (System Biosciences, Mountain View, CA). Viral supernatant was collected and used to infect Huh7 and Hep3B. The infected cells were selected with puromycin (Sigma-Aldrich). For overexpression study, either Sox9 expression construct (SC321884: NM_000346, human cDNA clone) or empty vector (Origene Technologies, Rockville, MD) were transfected into SMMC-7721 using Lipofectamine® 2000.
3
RPPA Analysis of Myc-tagged KPC1 in Melanoma
4
PARP-1 Overexpression in HCT-116 Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HCT-116 and HCT-116 p53 null cell lines were transfected with the plasmid pCMV6 containing the human PARP-1 gene and the corresponding empty vector (Origene Technologies, Rockville, MA, USA). For this purpose, 200.000 cells were seeded per well in a 6 well-plate. Once 60–70% confluence was reached, they were transfected with lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) as a transfection reagent, with a lipofectamine/DNA ratio of 2.5, according to the manufacturer’s instructions.
5
Analyzing SAA3 3'UTR Regulation by Regnase-1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SAA3–3′-UTR reporter plasmid, which contained the 5′-AATAAATACTTGTGAAATGCA-3′ sequence of 3′-UTR of SAA3, was purchased from GeneCopoeia. Primary-culture mouse chondrocytes were pretreated with hyaluronidase type I-S (Sigma) for 3 h in serum-free DMEM and transfected by incubation for 6 h with SAA3-3′-UTR reporter vector (0.05 μg) and Lipofectamine 2000, as described by the manufacturer. The cells were co-transfected with 0.05 μg of empty vector (Origene), WT-Regnase-1 expression vector (Origene), or D141N Regnase-1 (which lacks RNase activity) [13 (link)]. The cells were harvested at 24 h after treatment, and firefly luciferase and Renilla luciferase activities were measured using a Dual-Luciferase Assay System (Promega).
6
siRNA-Mediated Knockdown of BMP8A, TRIM24, and Nrf2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNA specifically targeting BMP8A, TRIM24, Nrf2 and non–specific si‐control were synthesized by GenePharma. Full‐length TRIM24 and empty vector were purchased from Origene. All transfection experiments of siRNA and plasmids were conducted using Jetprime Transfection Reagent (Polyplus) following the manufacturer’s instructions. The corresponding siRNA sequence information is as follows:
siRNA sequence (5′‐3′)
Si‐BMP8A #1: GGACTACCGTTCATATCCT
Si‐BMP8A #2: CGACGGACATAAGGAGACA
Si‐BMP8A #3: GCATGACTATGACGACTCA
Si‐TRIM24 #1: GAGCUCAUCAGAGGGUAAATT
Si‐TRIM24 #2: GCUGGACUCUCUAAACAAUTT
Si‐TRIM24 #3: GACUGUUCAAGUACUAUUATT
Si‐Nrf2: CCGGCAUUUCACUAAACACAA
Si‐Control: UUCUCCGAACGUGUCACGUTT
siRNA sequence (5′‐3′)
Si‐BMP8A #1: GGACTACCGTTCATATCCT
Si‐BMP8A #2: CGACGGACATAAGGAGACA
Si‐BMP8A #3: GCATGACTATGACGACTCA
Si‐TRIM24 #1: GAGCUCAUCAGAGGGUAAATT
Si‐TRIM24 #2: GCUGGACUCUCUAAACAAUTT
Si‐TRIM24 #3: GACUGUUCAAGUACUAUUATT
Si‐Nrf2: CCGGCAUUUCACUAAACACAA
Si‐Control: UUCUCCGAACGUGUCACGUTT
7
In Vitro Differentiation of Monocytes into M2 Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the in vitro differentiation of human monocytes (THP-1 cells; American Type Culture Collection) into CAMs, the cells were incubated for 48 h with 20 ng/ml IL-4 and 20 ng/ml IL-13 (PeproTech, Inc.) to obtain M2 polarized macrophages. Human gastric cell lines MGC-803 and BGC-823 (American Type Culture Collection) were cultured in RPMI-1640 medium (Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (FBS; Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C in a humidified incubator at 5% CO2. Cells were either treated with the supernatant from CAMs or the supernatant from CAMs+IL-10 antibody (cat. no. ab133575; 1:2,000; Abcam) for 72 h for further analysis. For cell profiling, MGC-803 cells were treated with IL-10 overexpression vector (Origene) and empty vector (Origene).
8
Syntenin Knockdown and Rescue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAis targeting Syntenin and the non-targeting control RNAi (si Ctrl) were purchased from GE healthcare Dharmacon Inc (Human syntenin (5′-GCAAGACCUUCCAGUAUAA-3′), Mouse syntenin smartpool (M-043821-01)). For rescue experiments, syntenin cDNA was cloned in pcDNA3.1/Zeo(+) (Thermofisher Scientific) and mutated by directed mutagenesis on three nucleotides in the sequence targeted by the siRNA (CCTTCCAGT mutated to CCGTCGAGC).
Empty vector, control shRNA and the 29 mer human and mouse shRNA sequences cloned in pGFP-V-RS vector were purchased from Origene [control shRNA GCACTACCAGAGCTAACTCAGATAGTACT (TR30013), Human syntenin shRNA 2 (GCCTAATGGACCACACCATTCCTGAGGTT (TG309594B/GI338370), shRNA 3 (GTGGCTCCTGTAACTGGTAATGATGTTGG (TG309594C/GI338371), Mouse shRNA (TCAGGCTCAAACTGCTTATTCTGCCAATC (TG512166A/GI574570)].
Empty vector, control shRNA and the 29 mer human and mouse shRNA sequences cloned in pGFP-V-RS vector were purchased from Origene [control shRNA GCACTACCAGAGCTAACTCAGATAGTACT (TR30013), Human syntenin shRNA 2 (GCCTAATGGACCACACCATTCCTGAGGTT (TG309594B/GI338370), shRNA 3 (GTGGCTCCTGTAACTGGTAATGATGTTGG (TG309594C/GI338371), Mouse shRNA (TCAGGCTCAAACTGCTTATTCTGCCAATC (TG512166A/GI574570)].
9
Overexpression of Clusterin in HEK293 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Clu CM was collected from cultured HEK293 cells. Briefly, ~ 90% confluent HEK293 cells were transfected with plasmid containing mouse Clu cDNA or empty vector (Origene) using Lipofectamine 3000 (Invitrogen) following the manufacturer’s instructions. Two days after transfection, the cells were washed with warm DPBS and placed in minimum medium containing phenol red-free Neurobasal, glutamax and Pen/Strep for 3 days. The medium was collected, concentrated 30–50 folds using centrifugal filter (Millipore, MWCO 10 K), and applied to primary cultured neurons at 30–40 μg/ml.
10
Regnase-1 Regulates SAA3 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SAA3-3´-UTR reporter plasmid, which contained the 5´-AATAAATACTTGTGAAATGCA-3´ sequence of 3
´-UTR of SAA3, was purchased from GeneCopoeia. Primary-culture mouse chondrocytes were pretreated with hyaluronidase type I-S (Sigma) for 3 hours in serum-free DMEM, and transfected by incubation for 6 hours with SAA3-3´-UTR reporter vector (0.05 µg) and Lipofectamine 2000, as described by the manufacturer. The cells were co-transfected with 0.05 µg of empty vector (Origene), WT-Regnase-1 expression vector (Origene), or D141N Regnase-1 (which lacks RNase activity) [13] . The cells were harvested at 24 hours after treatment, and re y luciferase and Renilla luciferase activities were measured using a Dual-Luciferase Assay System (Promega).
´-UTR of SAA3, was purchased from GeneCopoeia. Primary-culture mouse chondrocytes were pretreated with hyaluronidase type I-S (Sigma) for 3 hours in serum-free DMEM, and transfected by incubation for 6 hours with SAA3-3´-UTR reporter vector (0.05 µg) and Lipofectamine 2000, as described by the manufacturer. The cells were co-transfected with 0.05 µg of empty vector (Origene), WT-Regnase-1 expression vector (Origene), or D141N Regnase-1 (which lacks RNase activity) [13] . The cells were harvested at 24 hours after treatment, and re y luciferase and Renilla luciferase activities were measured using a Dual-Luciferase Assay System (Promega).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!