Total RNA was isolated using the Nuclezol LS RNA Isolation Reagent (ABP Biosciences, Inc). cDNA was synthesized using 1.0 ug of total RNA with the SureScript-First-strand-cDNA-synthesis-kit (GeneCopoeia, Guangzhou). Quantitative PCR was performed for hub genes using the BlazeTaq™ SYBR ® Green qPCR Mix 2.0 kit (GeneCopoeia) with the CFX96 real time quantitative PCR instrument (Bio-Rad, USA). The relative expression levels were determined by the 2−ΔΔCt method and normalized to internal control GAPDH. All qPCR reactions were performed in triplicate. The primers designed by Qingke Biology Co., Ltd are listed as below: FCN3-F: CAGGATGGTTCTGTGGATTT; FCN3-R: TCAGCGTCATAGGTGGTAAA; FOXO1-F: CTTCTGACTCTCCTCCCCACA; FOXO1-R: CCCATCCTACCATAGCCATTG; GAPDH-F: CGCTGAGTACGTCGTGGAGTC; GAPDH-R: GCTGATGATCTTGAGGCTGTTGTC.
Real time quantitative pcr instrument cfx96
Manufactured by Bio-Rad
Sourced in United States
The CFX96 is a real-time quantitative PCR (qPCR) instrument manufactured by Bio-Rad. It is designed to perform quantitative nucleic acid analysis. The instrument provides thermal cycling, optical detection, and data analysis capabilities for qPCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (4 mentions)
Rt qpcr kit, by Vazyme (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Surescript first strand cdna synthesis kit, by GeneCopoeia (1 mentions)
Blazetaq sybr green qpcr mix2.0 kit, by GeneCopoeia (1 mentions)
Rnaiso plus kit, by Takara Bio (1 mentions)
Cdna synthesis kit, by Yeasen (1 mentions)
Sybr green qpcr master mix, by Vazyme (1 mentions)
First strand cdna synthesis kit, by Beyotime (1 mentions)
Nanodrop one onec, by Thermo Fisher Scientific (1 mentions)
5 protocols using real time quantitative pcr instrument cfx96
1
Quantifying Expression of Hub Genes
2
Quantification of Gene Expression in Murine Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAiso Plus kit (Takara, Kyoto, Japan) was used to extract total RNA from RAW264.7 cells and lung tissues. After measuring the concentration and purity of RNA, complementary DNA was generated by cDNA synthesis kit (Yeasen, Shanghai, China), and SYBR Green qPCR master mix (Vazyme, Nanjing, China) was used to quantify the RNA levels. Amplification reactions were carried out on a CFX96 real-time quantitative PCR instrument (Bio-Rad, CA, USA), and each reaction was performed in triplicate. The relative expression of genes was calculated using the 2−ΔΔCT method, and β-actin gene served as control for standardization. The primer sequences are described in Table 1
3
Quantifying Gene Expression in Brain Ischemia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA in brain ischemic penumbra tissues collected 24 h after operation or neurons treated with OGD for 24 h was extracted by Trizol (16096020; Thermo Fisher Scientific, Inc), followed by reverse transcription using the First Strand cDNA Synthesis Kit (D7168L; Beyotime Biotechnology Co, Ltd). After that, RT-qPCR was performed according to the manuals of the RT-qPCR kit (Q511-02; Vazyme Biotech). PCR amplification was performed with Bio-rad real-time quantitative PCR instrument CFX96. The relative expression level of Smurf2, YY1, HIF1α, and DDIT4 was standardized by β-actin expression. These values were then exponentiated to the power of 2 (2−ΔΔCt) to yield fold expression relative to the reference point. The primers are depicted in Table S1 .
4
RNA Extraction, cDNA Synthesis, and RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by Trizol (16096020, Thermo Fisher Scientific), and the RNA concentration and purity were determined by using the NanoDrop One/OneC trace nucleic acid protein concentration tester (Thermo Fisher Scientific), which showed that A260/A280 = 2.0, and the concentration was >5 μg/μL. The RNA was synthesized using the complementary DNA first-strand synthesis kit (D7168L, Beyotime, Shanghai).
The RT-qPCR experiment was performed with the kit (Q511-02, Vazyme Biotech, Nanjing, China). PCR amplification was performed on a Bio-rad real-time quantitative PCR instrument CFX96. Primer sequences (Supplementary Table 2 ) were designed and provided by Sangon Biotech (Shanghai, China). With glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal reference, the mRNA levels were determined using the 2−ΔΔCt method.
The RT-qPCR experiment was performed with the kit (Q511-02, Vazyme Biotech, Nanjing, China). PCR amplification was performed on a Bio-rad real-time quantitative PCR instrument CFX96. Primer sequences (
5
Quantitative Analysis of Smurf2 and ALK5 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with the TRIzol reagent (16096020, Thermo Fisher Scientific), and the cDNA of mRNA was synthesized using the first-strand synthesis kit (D7168L, Beyotime Biotechnology Co., Ltd., Shanghai, China) according to the instructions. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was carried out using a RT-qPCR kit (Q511-02, Vazyme Biotech, Nanjing, China) according to the instructions. PCR amplification was carried out with Bio-rad real-time quantitative PCR instrument CFX96. β-actin served as the internal reference for Smurf2 and ALK5. All primer sequences were designed and provided by Sangon Biotech. The primer sequences are shown in Table 1 . The relative mRNA expression was measured using the 2-ΔΔCT method (Zhao et al., 2018 (link); Wan et al., 2019 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!