qRT-PCR was conducted to measure the expression of differentially expressed mRNA. The 12 mice were randomly divided into 4 groups, and the modeling mentioned above was employed to administer different stimuli to each group. Immediately after the stimulation, the mice were euthanized to obtain hippocampal tissue. Hippocampal RNA was extracted using a TSINGKE TSP413 RNAprep FastPure kit (Beijing Tsingke Biotechnology Co., Ltd.). Target genes were reverse transcribed and amplified using MightyScript First Strand cDNA Synthesis Master Mix (Sangon, Shanghai, China) according to the manufacturer’s instructions. Quantitative real-time PCR was performed with the LightCycler 480 (Roche, Rotkreuz, Switzerland) and SYBR Green PCR master mix (Yeasen, Shanghai, China). The fold change in the gene expression was calculated using the comparative Ct method, and three replicates were tested for each cDNA sample. The following primers were used (synthesized by Tsingke Biotechnology Co.): Slc17a6; 5′- GTCGGTAAAACAAAGGATTTTGGC -3′ (forward), 5′- GCTTCTTCTCCAGCACCCTGTA -3′ (reverse) and β-actin; 5′-AACAGTCCGCCTAGAAGCAC-3′ (forward), 5′-CGTTGACATCCGTAAAGACC-3′ (reverse). Gene expression levels were normalized to those of β-actin as an endogenous control. Each experiment was repeated at least three times.
Mightyscript first strand cdna synthesis master mix
Manufactured by Sangon
Sourced in China
MightyScript First Strand cDNA Synthesis Master Mix is a premixed solution used for the reverse transcription of RNA to complementary DNA (cDNA). It contains the necessary components for the first-strand cDNA synthesis reaction, including reverse transcriptase enzyme, buffer, and dNTPs.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 480, by Roche (1 mentions)
Sybr green pcr master mix, by Yeasen (1 mentions)
Sg fast qpcr master mix, by Sangon (1 mentions)
Plant total rna isolation kit, by Sangon (1 mentions)
Trizol reagent, by Sangon (1 mentions)
Sybr green fast qpcr master mix, by Sangon (1 mentions)
Sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Mirna first strand cdna synthesis tailing reaction, by Sangon (1 mentions)
5 protocols using mightyscript first strand cdna synthesis master mix
1
Hippocampal Gene Expression in Mice
2
Expression Analysis of PoC2H2-ZF Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the sampled primordia using the Plant Total RNA Isolation Kit (Sangon Biotech Co., Ltd, ShangHai). cDNA was generated using the MightyScript First Strand cDNA Synthesis Master Mix (Sangon Biotech Co., Ltd, ShangHai) according to the manufacturer’s protocol. The 2X SG Fast qPCR Master Mix (Sangon Biotech Co., Ltd, ShangHai) was used to perform qRT-PCR. The sar gene was used as the reference (Castanera et al., 2015 (link)) and the relative expression level of genes was analyzed using the 2−ΔCT or 2−ΔΔCT method. The primer sequences used for qRT-PCR are listed in Table S3 . A heatmap showing relative expression levels of PoC2H2-ZF genes was generated using Tbtools (Chen et al., 2020 (link)).
3
RT-qPCR analysis of Pseudomonas aeruginosa
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol™ Reagent (Sangon Bioengineering Co., Ltd., Shanghai, China, B511311-0100) was used to extract the total RNA from PAO1 cultures treated with varying concentrations of quercetin. Subsequently, MightyScript First Strand cDNA Synthesis Master Mix (Sangon Bioengineering Co., Ltd., Shanghai, China, G709KA6194) was used to perform reverse transcription of RNA into first-strand cDNA. Afterward, SYBR Green Fast qPCR Master Mix (Sangon Bioengineering Co., Ltd., Shanghai, China, B639271-0005) was employed for RT-qPCR amplification. Relevant specific primers are listed in Table S3 . 16S rRNA was chosen as the reference gene. By normalizing the cycle threshold (CT) of the target and reference genes, the 2-△△Ct method was used to determine the expression levels of the target gene.
4
Adhesion Assay and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We treated the bacteria with 10 µg/mL dictamnine and treated the cells according to the method of adhesion assay for 2 h. The RNeasy Mini Kit (Qiagen, Hilden, Duesseldorf, Germany) was used to extract total RNA from bacterial and T24 cells according to the manufacturer’s protocol. A Nanodrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) was used to determine the concentration and purity of extracted RNA. We removed the genomic DNA and performed cDNA synthesis using a Mighty Script First Strand cDNA Synthesis Master Mix (Sangon Biotech, Shanghai, China). SYBR@Green Master Mix (Applied Biosystems, Waltham, MA, USA) was used for RT-qPCR. The ΔCT method was used to calculate the threshold cycle (ΔCT) value of each gene to determine the relative mRNA level. The dnaE gene according to Dai [38 (link)] and human housekeeping gene β-actin were used as reference genes for bacterial and T24 cells, respectively. The PCR primers used in this study are shown in Table 1 . The analysis of samples was based on at least three independent experiments.
5
Quantitative Gene Expression Analysis in Rat Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues of 3 rats in each group on days 1, 3, 7, and 14 and from cells using the TRIzol reagent (Invitrogen Inc., Carlsbad, CA, USA) and reverse transcribed into complementary DNA (cDNA) using miRNA First Strand cDNA Synthesis (Tailing Reaction) (B532451, Shanghai Sangon Biotechnology Co. Ltd., Shanghai, China) and MightyScript First Strand cDNA Synthesis Master Mix (B639251, Sangon). The reverse transcribed cDNA was diluted to 10 times. The expression of relevant genes was analyzed and normalized to U6 (for miRNA), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (for other genes). Fold changes were calculated using relative quantification (the 2−∆∆Ct method): ∆∆Ct = ∆Ct model group − ∆Ct normal group, ∆Ct = Ct (target gene) − Ct (internal reference). The primer sequences used are shown in Additional file 1 : Table S1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!