MG132, Bortezomib/Velcade, NAE inhibitor MLN 4924, AAA-ATPase p97 inhibitor DBeQ were purchased from LifeSensors (Malvern, PA). Carfilzomib were obtained from APExBIO technology. All inhibitors were dissolved in DMSO. The inhibitors were added to the muscle cells after 4 days of culture. To reverse the drug effects, the treated cells were washed, trypsinized, spun down, rinsed with control medium, and then replated onto gelatin-coated dishes (hiPSC) or collagen-coated dishes (chick) in control medium. The control and different previously UPS inhibitor treated cardiomyocytes were allowed spread in culture over two days for recovery, and then processed for immunostainings to detect reversibility.
Mln4924
Manufactured by LifeSensors
MLN4924 is a small molecule inhibitor that targets the NEDD8-activating enzyme (NAE). It acts by preventing the activation and conjugation of the NEDD8 protein, which is crucial for the function of the cullin-RING E3 ubiquitin ligases. MLN4924 has been used as a research tool to study the role of the NEDD8 pathway in various cellular processes.
Automatically generated - may contain errors
Lab products found in correlation
Carfilzomib, by Apexbio (1 mentions)
Supersignal west pico plus, by Thermo Fisher Scientific (1 mentions)
Chemidoc imaging system, by Bio-Rad (1 mentions)
Horseradish peroxidase conjugated secondary antibody, by Promega (1 mentions)
Mg132, by Peptide Institute (1 mentions)
Supersep ace precast gels, by Fujifilm (1 mentions)
3 protocols using mln4924
1
Reversible Proteasomal Inhibition in Cardiomyocytes
2
Ubiquitylation Assay with Proteasome Inhibitors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunoprecipitation was performed as described previously (43 (link)). Cells were incubated for 6 hours in the presence of MG132 (10 μM; Peptide Institute) or MLN4924 (1 μM; LifeSensors) before lysis for the ubiquitylation assay. Protein samples were subjected to SDS-polyacrylamide gel electrophoresis on 5 to 20% SuperSep Ace Precast Gels (Wako), membranes were incubated consecutively with primary antibodies and horseradish peroxidase–conjugated secondary antibodies (Promega), and signals were visualized with SuperSignal West Pico PLUS or Dura reagents (Thermo Fisher Scientific) and a ChemiDoc imaging system (Bio-Rad). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), α-tubulin, and Hsp90 were examined as loading controls.
3
Characterizing MdmX Regulation via CRISPR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The shMdmX, MdmX, and ΔC MdmX constructs were obtained [46 (link)]. Lentiviral CRISPR to Mdm2 was created with forward and reverse Mdm2 CRISPR primers (CACCGTTGGGCCCTTCGTGAGAAT and AAACATTCTCACGAAGGGCCCAAC respectively) to exon 12 cloned into the Lenticrispr vector (pXPR_001 obtained from Clark Wells) as described [47 (link)].
Viral transductions were conducted as described [48 (link)]. H1299, U87, TMD231, MEF and MCF7 cells were incubated at 37°C in a humidified chamber with 5% CO2 in DMEM high glucose and 8-10% fetal bovine serum. Transient transfections were performed using 1:1 DNA to PEI (H1299). Equal amounts of DNA were transfected into cells except for neddylation assays (see figure legend). Unless indicated, cells were treated with 0.3 μm MLN4924 (Life Sensors), 2 mM Caffeine and/or 10 μM ATMi (KU-55933 (Millipore) for 18 h.
Viral transductions were conducted as described [48 (link)]. H1299, U87, TMD231, MEF and MCF7 cells were incubated at 37°C in a humidified chamber with 5% CO2 in DMEM high glucose and 8-10% fetal bovine serum. Transient transfections were performed using 1:1 DNA to PEI (H1299). Equal amounts of DNA were transfected into cells except for neddylation assays (see figure legend). Unless indicated, cells were treated with 0.3 μm MLN4924 (Life Sensors), 2 mM Caffeine and/or 10 μM ATMi (KU-55933 (Millipore) for 18 h.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!