Strong water-binding capacity (SWBC) is defined as the amount of water bound by bran when an external force is applied, while bran and water are not in contact after application of the external force. A QIAprep Spin Miniprep Column (Qiagen, Hilden, Germany) was used, consisting of a filter as the upper part that is placed in an Eppendorf tube as the lower part. An amount of 50.0 mg of bran was weighed on the filter and 700 µL of water was added. Bran was hydrated for 60 min and afterwards centrifuged (10 min, 4000× g, room temperature). SWBC was than calculated as the amount of water that was bound by bran after the centrifugation step. To account for the water that was taken-up by the filter, three blank columns were included in the analysis and used for correction. The procedure was performed in triplicate.
Qiaprep spin miniprep column
Manufactured by Qiagen
Sourced in Germany
The QIAprep spin miniprep columns are a laboratory equipment used for the rapid and efficient purification of plasmid DNA from bacterial cultures. The columns utilize a silica-based membrane to selectively bind and purify plasmid DNA, allowing for the removal of contaminants such as proteins, RNA, and other cellular components.
Automatically generated - may contain errors
Lab products found in correlation
Bigdye terminator v3.1 ready reaction mix, by Thermo Fisher Scientific (1 mentions)
Contigexpress, by Thermo Fisher Scientific (1 mentions)
3730 dna analyzer, by Thermo Fisher Scientific (1 mentions)
T4 dna ligase, by Thermo Fisher Scientific (1 mentions)
Dreamtaq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Instagene matrix, by Bio-Rad (1 mentions)
Kapa hifi hotstart dna polymerase, by Roche (1 mentions)
Wizard genomic dna purification kit, by Promega (1 mentions)
Clonejet pcr cloning kit, by Thermo Fisher Scientific (1 mentions)
Restriction enzyme, by New England Biolabs (1 mentions)
Dna ligase, by New England Biolabs (1 mentions)
Gene pulser, by Bio-Rad (1 mentions)
9 protocols using qiaprep spin miniprep column
1
Quantifying Bran Water-Binding Capacity
2
Measuring Bran's Water Retention and Extractability
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total water retention capacity (TWRC) and extractability were determined by weighing 1.000 g of bran in a falcon tube, adding 30.0 mL of water, shaking for 30 min (150 rpm, room temperature) and decanting the supernatant after centrifugation (4000× g, 10 min, 25 °C). The pellet was weighed and reweighed after drying in an oven (90 °C) overnight. The TWRC and extractability were calculated by using the following formulas:
The strong water retention capacity (SWRC) was determined as described by De Bondt et al. [16 (link)], with small adaptations. 25 mg of sample was weighed on the upper part of a QIAprep Spin Miniprep Column (Qiagen, Hilden, Germany) and 350 µL of water was added. A column without sample was used as a blank to correct for the amount of water held by the filter. After one hour of resting, the samples were centrifuged (10,000× g, 10 min, 25 °C). The column was weighed and reweighed after drying in an oven (90 °C) overnight. Similar to the TWRC, the SWRC was calculated as the amount of water held by the bran, corrected for the blank.
The strong water retention capacity (SWRC) was determined as described by De Bondt et al. [16 (link)], with small adaptations. 25 mg of sample was weighed on the upper part of a QIAprep Spin Miniprep Column (Qiagen, Hilden, Germany) and 350 µL of water was added. A column without sample was used as a blank to correct for the amount of water held by the filter. After one hour of resting, the samples were centrifuged (10,000× g, 10 min, 25 °C). The column was weighed and reweighed after drying in an oven (90 °C) overnight. Similar to the TWRC, the SWRC was calculated as the amount of water held by the bran, corrected for the blank.
3
Evaluating Bran Water Retention Capacity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The strong water retention capacity measures the amount of water that can be bound by bran when an external force is applied and when bran and water are not in contact anymore after application of the external force. A QIAprep Spin Miniprep Column (Qiagen, Hilden, Germany) consisting of an Eppendorf tube at the lower part and a filter at the upper part was used. Bran (50.0 mg) was weighed in the upper part of the column and water (700 µL) was added. After 60 min of hydration, centrifugation (10 min, 20 °C) was performed at 4000 g for endosperm depleted wheat, rye and maize bran and at 10 000 g for endosperm depleted oat bran. A higher speed was needed for oat bran as this sample displayed a high extract viscosity and water could not pass through the filter at 4000 g. After centrifugation, the solvent was unable to make contact with the bran, as it is located in the lower part of the column. The strong water retention capacity was afterwards calculated as the amount of solvent that was still present in the bran material after centrifugation. Three columns without bran were included in the procedure to correct for the amount of water that was taken up by the filter.
4
Plasmid Library Representation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the representation of the test constructs in the plasmid library, 28 individual colonies were grown in LB-broth containing 100 μg/ml ampicillin. Plasmids were isolated using QIAprep® Spin miniprep columns (Qiagen, Germantown, MD, United States) as per manufacturer’s instructions and Sanger sequenced using a primer (GTGGTTTGTCCAAACTCATC) near the test insert (ACGT, Inc., Wheeling, IL, United States).
5
DNA Extraction and Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid DNA was isolated from E. coli, B. subtilis and C. difficile using QIAprep spin miniprep columns (Qiagen) following the manufacturer’s instructions. Genomic DNA was isolated from C. difficile as previously described [44 (link)]. Standard methods of DNA digestion, modification and ligation were used. DNA sequencing was carried out using BigDye Terminator v3.1 Ready Reaction Mix (Applied Biosystems) following the manufacturer’s instructions. Sequencing reactions were resolved on an Applied Biosystems 3730 DNA Analyzer. Sequences were analysed using ContigExpress (Invitrogen).
6
Bacillus cereus DNA Isolation and Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromosomal DNA was isolated from B. cereus using the Wizard Genomic DNA Purification kit (Promega) for sequencing reactions and using InstaGene Matrix (Biorad) for fast colony PCR screening. Plasmid DNA was extracted using QiaPrep spin miniprep columns (Qiagen). Oligonucleotide primers (Table 1 ) were synthesized by Sigma. PCR amplification for cloning and sequencing was performed using KAPA HiFi Hotstart DNA Polymerase (Kapa Biosystems, Inc. Wilmington) whereas DreamTaq DNA polymerase (Fisher Scientific) was used for control PCR reactions. Restriction enzymes, T4 DNA ligase and FastAP Termosensitive Alkaline Phosphatase were obtained from Fisher Scientific and used according to manufacturer’s instructions. Plasmid constructs and B. cereus deletion and complementation clones were confirmed by DNA sequencing (Baseclear, Leiden, The Netherlands).
7
Development of Transposon-Based pyrF Vector
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Pgdh-pyrF cassette, containing 283-bp portion of the intergenic region upstream of gdh (PF1602) joined with pyrF gene and T1 terminator from the histone gene hpyA1 (PF1722), was amplified from pJFW07023 (link) plasmid DNA using primers Tn_pyrF_for (containing IRL-sequence and a sequence carrying stop codons in all 6 possible reading frames) and Tn_pyrF_rev (containing IRR-sequence and a sequence carrying stop codons in all 6 possible reading frames). The PCR product was purified and cloned in pJET1.2/blunt vector using CloneJET PCR Cloning Kit following the manufacturer’s instructions (Thermo Scientific, #K1231). The resulting plasmid, named, pNG-Tn-pyrF, was used for in vitro transposition. E. coli DH5α cells were transformed by chemical transformation. Plasmid DNA was isolated from liquid cultures by using QIAprep spin miniprep columns (Qiagen). The plasmid constructs were confirmed by restriction analysis and Sanger sequencing. The full sequence of pNG-Tn-pyrF is available upon request.
8
Genetic Modification of Pseudomonas aeruginosa
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For cloning, E. coli DH10B was used as the host strain. DNA was electroporated into E. coli as previously described [50 (link)] using the Gene Pulser by Bio-Rad (Hercules, CA). DNA fragments were excised and purified from agarose gels using Qiaex II DNA gel extraction kit and plasmids were purified with Qiaprep spin miniprep columns (Qiagen, Germantown, MD) according to the manufacturer’s instructions. Restriction enzymes, DNA ligase, and Taq were purchased from New England Biolabs (Ipswich, MA). Pfu DNA polymerase was purchased from Stratagene (La Jolla, CA). All enzymes were used according to the manufacturers’ instructions. Conjugation via triparental mating to introduce plasmid DNA into P. aeruginosa was performed as previously described [50 (link)]. Pseudomonas Isolation Agar from Difco was used to counter select against E. coli during triparental mating. An alkaline protease (apr) mutant of FRD740 (ΔlasB) was constructed by cloning the apr gene by PCR, inserting a gentamycin-resistance cassette (GmR) into the apr open reading frame, and crossing it into the FRD740 chromosome for allelic replacement to form strain FRD1185.
9
Quantifying Oil Absorption in Bran
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bran (50.0 mg) was weighed in QIAprep Spin Miniprep Columns (Qiagen, Hilden, Germany). Sunflower oil (700 µl) was added, and the sample was stored at room temperature for 1 hour. After the incubation period, the sample was centrifuged at 4000g for 10 min at 25
°C. The amount of oil strongly bound in/to the bran structure that could not be separated from it using centrifugal force was then determined by subtracting the initial weight of the bran sample from the weight of the sample with the amount of oil absorbed by it. Experiments were performed in triplicate.
°C. The amount of oil strongly bound in/to the bran structure that could not be separated from it using centrifugal force was then determined by subtracting the initial weight of the bran sample from the weight of the sample with the amount of oil absorbed by it. Experiments were performed in triplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!