Colorless buffer

The primers 27F (5' AGA GTT TGA TCM TGG CTC AG 3') [9] and 1041R (5' CGG TGT GTA CAA GAC CC 3') [10] (link) were used to PCR amplify the 16S RNAr gene. In each reaction, these primers were employed at a final concentration of 0.4 mol/m 6 in addition to 0.05 mol/m 3 dNTP mix, 0.025 U/µL Taq DNA Polymerase, 21 mol/m 3 MgCl 2 , 10 µL of Colorless Buffer (Promega, USA), and 32.75 µL of ultrapure H 2 O. PCR run was performed on a MULTIGENE Labnet thermocycler, with the following thermocycling program: 95 °C for 2 minutes, 30 cycles of 94 °C for 2 minutes, 55 °C for 1 minute and 72 °C for 3 minutes; and a final extension of 10 minutes at 72 °C. Amplicons were revealed by 1 % agarose gel electrophoresis; employing a 1 kb DNA Ladder (Promega, USA) as molecular size marker, and Gel Red (Biotium, USA), as an intercalator. The run conditions were 70 V for 1 hour and 30 minutes in Multisub Electrophoresis System Cleaver Scientific chamber. The gel was visualized in a SmartDoc Imaging Enclosure Benchmark Accuris E300 UV photodocumentation system at a wavelength of 302 nm [8] .

To further asses the identity of the bacterial isolates from UTI samples, the molecular fingerprint of the enterobacterial repetitive intergenic consensus (ERIC) region was studied via PCR. The PCR primers employed were ERIC 1 (5' TGTAAGCTCCTGGGGAT3') and ERIC 2 (5'AAGTAAGTGACTGGGGGTGAGC 3 ') [11] (link). Each reaction was conducted at a final volume of 50 µL and consisted of 0.4 mol/m 6 of primers, 0.05 mol/m 3 dNTP mix, 0.025 U/µL Taq DNA Polymerase, 21 mol/m 3 MgCl 2 , 10 µL of Colorless Buffer (Promega, USA), and 32.75 µL of ultrapure H 2 O. The samples were run in a MULTIGENE Labnet thermocycler with the following program: 95 °C for 7 minutes; 30 cycles of 94 °C for 1 minute, 52 °C for 1 minute, 65 °C for 8 minutes; and a final extension at 65 °C for 15 minutes [11] (link). The amplicons were inspected in electrophoresis in 1 % agarose gels-(1X TAE); the 1 kb DNA ladder (Promega) was used as a molecular marker, and Gel Red (Biotium, USA) was used as an intercalator. The run conditions were 70 V for 90 minutes in a Multisub Electrophoresis System Cleaver Scientific chamber. The gel was visualized in a SmartDoc Imaging Enclosure Benchmark Accuris E300 UV photodocumentation system at a wavelength of 302 nm. Subsequently, the polymorphisms were analyzed with the NTSYS Spc 2.1 software (License UH3071IX).

The primers 341F-GC + glue GC 5 '(CCTACGGGAGGCAGCAG) 3' [15] (link) and 907R 5 '(CCGT-CAATTCMTTTGAGTTT) 3' [15] (link) were used for amplification. PCR reactions were performed at a volume of 50 µL, a final concentration of 0:40 µM of primers, a mix of dNTPs at 0:05 mM, Taq DNA Polymerase at 0:025 U µL 1 , 1 mM MgCl 2 , 10 µL of colorless buffer (Promega; Madison, Wisconsin, USA), and 32:75 µL of sterile ultrapure water. A DNA template was added for each of the samples at a concentration of 15 ng µL 1 . Water was used as a negative control, and E. coli DNA was used as a positive control.
The PCR reaction was performed in a Multigene Labnet thermocycler with the following thermocycling program: 94 °C for 10 min; 35 cycles of 94 °C for 1 min, 54 °C for 1 min, and 72 celsius for 2 min; and a final extension of 10 min at 72 °C.
The PCR products were visualized on 1 % agarose gels treated with ethidium bromide (5 µg mL 1 ). The gels were run in 1X TAE buffer for 1 h at 70 V using 100 bp as a molecular size marker (Promega; Madison, Wisconsin, USA). The gels were visualized on a Benchtop 3UV Transilluminator photo-documentator at a wavelength of 302 nm.