Total RNA was isolated from cells using the Tri Reagent (Sigma), and reverse transcription was performed with Protoscript II Reverse Transcriptase (NEB). PCR was carried out using SYBR Green JumpStar Taq ReadyMix (Merck) in the StepOnePlus real-time PCR system (Applied Biosystems). Primer sequences are provided in Additional file 1 : Table S1, and two housekeeping genes, β-ACTIN and RPL22, were used, which showed similar patterns. Thus, the relative quantification of target gene expression was calculated using the 2−ΔCt method with RPL22 as the normalizer.
Sybr green jumpstar taq readymix
Manufactured by Merck Group
SYBR Green JumpStar Taq ReadyMix is a pre-formulated solution containing SYBR Green I dye and Taq DNA polymerase for real-time PCR amplification. It is designed to simplify real-time PCR setup and provide consistent results.
Automatically generated - may contain errors
Lab products found in correlation
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Tri reagent, by Merck Group (2 mentions)
Protoscript 2 reverse transcriptase, by New England Biolabs (2 mentions)
Rotor gene, by Qiagen (1 mentions)
Genelute total rna purification kit, by Merck Group (1 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Superscript 3 first strand synthesis supermix, by Thermo Fisher Scientific (1 mentions)
Dnase 1, by Qiagen (1 mentions)
Lightcycler 480, by Roche (1 mentions)
5 protocols using sybr green jumpstar taq readymix
1
Quantitative Real-Time PCR Protocol
2
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using the Tri Reagent (Sigma), and reverse transcription was performed with Protoscript II Reverse Transcriptase (NEB). PCR was carried out using SYBR Green JumpStar Taq ReadyMix (Merck) in the StepOnePlus real-time PCR system (Applied Biosystems). Primer sequences are provided in Additional file 1 : Table S1, and two housekeeping genes, β-ACTIN and RPL22, were used, which showed similar patterns. Thus, the relative quantification of target gene expression was calculated using the 2−ΔCt method with RPL22 as the normalizer.
3
Real-time RT-PCR analysis of L. monocytogenes virulence gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The effect of the EO on the expression of L. monocytogenes virulence genes was investigated using real time RT-PCR. Strains were grown in presence of EO at 30°C in TSB, and total RNA was extracted using GenElute total RNA Purification kit (Sigma Aldrich). cDNA synthesis was performed using the Quantitect Reverse Transcription kit (Qiagen, Hilden, Germany) and synthesized cDNA was used as the RT-qPCR template. The amplification product was detected using SYBR Green reagents (SYBR Green JumpStar Taq ReadyMix, Sigma Aldrich) by Rotor-Gene (Qiagen). The primers for each gene are reported in Table 2 . Data were normalized to the endogenous control (16S rRNA) and the level of candidate gene expression between treated and untreated samples was compared to study relative gene expression and the effect of EO on each gene.
4
Transcriptome-Proteome Correlation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To investigate whether gene expression is correlated between transcript and protein level, quantitative real-time PCR was
performed for 10 genes selected based on proteomic data. Total RNA was extracted from seedlings of maize with Trizol reagent
(Invitrogen) accordancing the manufacturer’s instructions. Genomic DNA contamination was removed with DNaseI (Qiagen, Inc) treatment.
The SuperScript™ III First-Strand Synthesis SuperMix (Invitrogen) was used for total RNA to reverse transcribe into first strand cDNA.
The qRT-PCR were conducted using the SYBR Green JumpStar™ Taq ReadyMix™ (Sigma-Aldrich). The qRT-PCR was conducted in the Bio-Rad
CFX 96 sequence detection system according to the manufacturer’s instructions. The reaction system consisted of 2 μL primers
(25pmol·uL-1, sense /antisenese primer sequences seen in Supplementary Table), 0.5 μL Sybr green I, 2 μL cDNA template,
and diethy pyrocarbonate (DEPC) water was used to complement to 25 μL. The amplification procedure was as follows: pre-denaturation
at 94 °C for 4 min; 35 cycles of amplification at 94 °C for 20 s, 60 °C for 30 s and 72 °C for 30 s; and 10 min of extension at
72 °C. Each experiment was repeated three times. The actin 2 gene was used as the internal reference for normalization.
performed for 10 genes selected based on proteomic data. Total RNA was extracted from seedlings of maize with Trizol reagent
(Invitrogen) accordancing the manufacturer’s instructions. Genomic DNA contamination was removed with DNaseI (Qiagen, Inc) treatment.
The SuperScript™ III First-Strand Synthesis SuperMix (Invitrogen) was used for total RNA to reverse transcribe into first strand cDNA.
The qRT-PCR were conducted using the SYBR Green JumpStar™ Taq ReadyMix™ (Sigma-Aldrich). The qRT-PCR was conducted in the Bio-Rad
CFX 96 sequence detection system according to the manufacturer’s instructions. The reaction system consisted of 2 μL primers
(25pmol·uL-1, sense /antisenese primer sequences seen in Supplementary Table), 0.5 μL Sybr green I, 2 μL cDNA template,
and diethy pyrocarbonate (DEPC) water was used to complement to 25 μL. The amplification procedure was as follows: pre-denaturation
at 94 °C for 4 min; 35 cycles of amplification at 94 °C for 20 s, 60 °C for 30 s and 72 °C for 30 s; and 10 min of extension at
72 °C. Each experiment was repeated three times. The actin 2 gene was used as the internal reference for normalization.
5
Real-Time RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cDNA was used as starting material for real-time RT-PCR quantitation with SYBR Green JumpStar Taq ReadyMix (Sigma) on a real-time PCR system (Light Cycler 480; Roche). For the amplification of the specific genes the following primers were used; hIFN-α, forward, GAAATACTTCCAAAGAATCACTCT and reverse, GATCTCATGATTTCTGCTCTGACA ; mTNFα, forward, CATCTTCTCAAAATTCGAGTGACAA and reverse, TGGGAGTAGACAAGGTACAACCC ; hTNFα, forward, CCCAGGGACCTCTCTCTAATCA and reverse, AGCTGCCCCTCAGCTTGAG , mCCL5, forward, GGAGATGAGCTAGGATAGAGGG and reverse TGCCCATTTTCCCAGGACCG ; hCCL5, forward, TGTGGTAGAATCTGGGCCCTTCAA and reverse, TGCCTGTTTCTGCTTGCTCTTGTC . For each mRNA quantification, the housekeeping gene GAPDH was used as a reference point using the following primers, mGAPDH forward, GCACAGTCAAGGCCGAGAAT , and reverse, GCCTTCTCCATGGTGGTGAA ; hGAPDH forward, TCGACAGTCAGCCGCATCTTCTTT , and reverse, ACCAAATCCGTTGACTCCGACCTT . It was confirmed that the expression of GAPDH was not affected by the various treatments. Real-time PCR data were analysed using 2–ΔΔCT method as described [20] (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!