Lightcycler 96 instrument

P. aeruginosa PAO1 was grown in LB medium supplemented with or without 2 mg/ml of thymoquinone at 37°C at 180 rpm for 24 h. DMSO was used as the negative control. After incubation, cells were collected by 10-min centrifugation at 10,000 g at 4°C and then washed with precooled sterile PBS. Total RNA was extracted using TRIzol® Reagent according the manufacturer’s instructions (Invitrogen) and genomic DNA was removed using DNase I (TaKara), and 10 DEGs involved in quorum sensing, virulence factors, TCA cycle, and drug resistance were selected to validate the RNA-Seq results using RT-qPCR analysis. The reference gene rpsL was selected for normalization and the primers were listed in Table 1. The RT-qPCR was carried out in a 20 μl system using MonAmpTM SYBR Green qPCR mix (Monad, China) as recommended by the manufacturer. The reactions were performed using LightCycler 96 Instrument (Roche Diagnostics, United States) with the following cycle parameters: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 60°C for 30 s, and 95°C for 15 s. All treatments were performed in triplicate and the 2^−ΔΔCt method was used to determine the fold changes of the candidate genes (Qian et al., 2020 (link)).

The total RNA was extracted using Trizol. Freshly isolated RNA was reverse-transcribed using a high-capacity cDNA reverse transcription kit (Thermo Fisher, Cat#4368814, Waltham, MA, USA) following the manufacturer’s recommendations. The sequences of gene primers used for the real-time PCR were as follows: BSP forward 5′-GCGAAGCAGAAGTGGATGAAA-3′ and reverse 5′-TGCCTCTGTGCTGTTGGTACTG-3′; OC forward 5′-CGCCTGGGTCTCTTCACTAC-3′ and reverse 5′- CTCACACTCCTCGCCCTATT-3′; GAPDH forward 5′-TGCACCACCAACTGCTTAGC-3′ and reverse 5′-GGCATGGACTGTGGTCATGAG-3′. All primers were mixed with SYBR^™ Green PCR Master Mix (Thermo Fisher, Cat#4344463, Madison, WI, USA) and examined using a LightCycler^® 96 Instrument (Roche).

Quantitative RT-PCR of cDNA samples from S2 cells was performed with a SYBR Green I-based reaction mix (FastStart Essential DNA Green Master (Roche Life Science, Switzerland)) and gene-specific primer pairs (designed using Primer3 software and NCBI Primer BLAST) (S1 File of S1 Table) on a LightCycler 96 Instrument (Roche Life Science, Switzerland). Reaction mixtures included 5 μL 2x FastStart Essential DNA Green Master, 1 μL primer mix (5 μM forward primer, 5 μM reverse primer) and 4 μL cDNA diluted 1:50 in nuclease-free water. All reactions were run in triplicates in 96-well plates and prepared using a repeater pipette (Repeater Xstream pipette, Eppendorf, Germany). qPCR conditions included a preincubation step at 95 °C for 10 min and 45 cycles of a 3-step-amplification consisting of 95 °C for 10 s, 60 °C for 10 s and 72 °C for 10 s. qPCR data was analyzed using the comparative ΔΔCt method [27 (link)]. Expression levels of Ribosomal protein L32 (RpL32) were used for normalization. Robustly constant expression of RpL32 across samples was verified by quantification relative to a second endogenous reference gene, ATPsynCF6.

Reverse transcription of total RNA (500 ng) was performed as previously described [32 (link)]. qPCR was conducted in triplicate using SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA) and two separate sets of oligonucleotide primers specific for Homo sapiens cyclin-dependent kinase inhibitor 1A (CDKN1A), transcript variant 1, mRNA (p21), (upstream 5’- TGGAGACTCTCAGGGTCGAAA-3’, downstream:5′ GGCGTTTGGAGTGGTAGAAATC-3’ Invitrogen, Milan, Italy) and glyceraldehyde-3 phosphate dehydrogenase (GAPDH) (upstream 5′-GAA GGT GAA GGT CGG AGT CA-3′; downstream: 5′-CAT GGG TGG AAT CAT ATT GGA A-3′; Invitrogen, Milan, Italy) [33 (link)] (Light Cycler@96 instrument (Roche, Mannheim, Germany) was programmed with an initial step of 30 seconds at 95° C, followed by 40 thermal cycles of 15 seconds at 95° C and 60 seconds at 60° C for GAPDH and p21. Melting curve analysis was employed to exclude nonspecific amplification products. The comparative C_t method (ΔΔC_t) was used to quantify gene expression and the relative quantification (RQ) was calculated as 2^−ΔΔCt.

RNA was obtained from frozen tissues using the RNeasy Mini extraction kit with RNase-free DNase on the column digestion kit (Qiagen, Sydney, NSW, Australia) according to the manufacturer’s protocol. RNA yield was quantified using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Random hexamer primed cDNA was prepared using the SuperScript VILO cDNA synthesis kit (Life Technologies) according to manufacturers’ protocols. Quantitative PCR was performed on the genes of interest listed in Table 1 using an Lightcycler 96 instrument (Roche, Sydney, NSW, Australia) and the Roche Universal Probe Library (Roche, AU). The expression of each gene was related to external housekeeping gene assay Luciferase (Roche, AU).

A SteadyPure Universal RNA Extraction Kit (Accurate Biology, Changsha, China) was used to extract the total RNAs of OSCC cells. The concentration of each total RNA was measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). In total, 1 000 ng of each total RNA was reverse transcribed to complementary DNA using an Evo M-MLV RT Kit for qRCR (Accurate Biology). A SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biology) was used to perform PCR reactions with a LightCycler96 Instrument (Roche Diagnostics, Basel, Switzerland) following the manufacturer’s instructions and the PCR program was carried out at 95 °C for 30 s, followed by 45 cycles at 95 °C for 5 s and at 60 °C for 30 s and ended with an elongation step for 15 s at 72 °C. Relative mRNA expression levels were normalized to the mRNA expression level of GAPDH. The primers of all genes tested are shown in Table S1.

The total RNA of the frozen colonic tissues and colonic organoids were extracted and quantified by using Eastep® Super Total RNA Extraction Kit (Promega, China). The homogenate of whole colonic tissues of each groups' rats were prepared by using an electric homogenizer. The reverse transcription (cDNA) was synthesized from 2 μg of total RNA using the GoScript™ Reverse Transcription System (Promega, China) according to the manufacturer's instructions. Quantitative Real‐time PCR was performed using 2 μl first‐strand cDNA with the GoScript® qPCR Master Mix (Promega), in a final volume of 20 μl. The following primers sequences were used: Cdh1, 5′‐TTGAGAATGAGGTCGGTGCC‐3′ (forward) and 5′‐CAGAATGCCCTCGTTGGTCT‐3′ (reverse); Ocln, 5′‐CTAAATTGGCATCCAGCCCAG‐3′ (forward) and 5′‐TCCTTTCCACTCGGGCTCA‐3′ (reverse); GADPH, 5’‐CAGTGCCAGCCTCGTCTCAT‐3′ (forward) and 5’‐AGGGGCCATCCACAGTCTTC‐3′ (reverse). The amplification condition was set at 40 cycles at 95°C for 15 s and 60°C for 30s using a LightCycler® 96 Instrument (Roche Life Science, Germany). The relative differences in expression of mRNA were measured by using 2^−ΔΔCt method and normalized. The gene results for each rat's colon were expressed as log₁₀‐transformed number of genome equivalent copies per ml by comparing the Ct values to the standard curves.