T4 dna ligase

Luciferase reporter was constructed with the promoter variants as shown in Figure 1. The promoter region of each gene was amplified by polymerase chain reaction (PCR) with the primers designed in Supplementary http://links.lww.com/MD/A104. Restriction enzyme sites (Kpn I, Xho I, and BglII) were also added to each set of primers to facilitate posterior cloning of the PCR products (Figure 1). The PCR product covered the selected variants including downstream region (1–101 bp) of each gene. The PCR products were ligated into T-blunt vector (Promega, Madison, WI) using T4 DNA Ligase (Promega). The ligated plasmids were amplified using E coli DH5α. They were double-digested by Kpn I, Xho I, and BglII (NEB, Ipswich, MA) to release the fragments containing the promoter of each gene. The released fragments were subcloned upstream of the firefly luciferase reporter gene in the pGL3-Basic vector (Promega) using T4 DNA Ligase (Promega). Site-directed mutagenesis was performed to substitute appropriate nucleotide variants (QuickChange^™ Site-Directed Mutagenesis Kit, Stratagene, La Jolla, CA). The sequences of all inserts were verified by direct sequencing.

For retrovirus infection, Irf8 was cloned into pMYs-IRES-GFP retroviral vector (Cell Biolabs) as previously described^{8 (link)}. cDNA was amplified by PCR using the following pairs of oligo-nucleotide primers 5′-aactcgagaacaccatgtgtgaccg-3′ and 5′-tagtggcagattatcgccggcgat-3′. The ligation of DNA fragments was performed with T4 DNA ligase (M1801, Promega). The orientation of the insert was determined by PCR and restriction enzyme digestion.
ShRNA specific for Irf8 (5′-ccaggctttccgcatgtttttcaagagaaaacatgcggaaagcctgg-3′) was cloned into pMXs-U6-GFP retroviral vector (Cell Biolabs). BamHI and EcorI restrictions enzyme sites were introduced for subcloning. The ligation of DNA fragments was performed with T4 DNA ligase (M1801, Promega).
Retroviral particles were generated by transfecting the platinum-E cells with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. After 2 days, fresh virus supernatant was harvested and mixed with proliferative CD4⁺ naive T cells and 10 μg/ml protamine sulphate (APP Pharmaceuticals) in a 24-well plate and centrifuged for 90 min at 2,000 × g at 32 °C. The transduced naive CD4⁺ T cells were collected after 2 days and cell-sorted according to GFP expression. GFP⁺ cells were differentiated as described above. After 3 days, the cells were collected for PCR and ELISA assays.

As it was previously described for SLPI^{32 (link)} cementoin mRNA was extracted from HeLa cells (epitheloid cervix carcinoma) and reverse-transcribed to cDNA using oligo-dT primers with MMLV-RT (Promega, Madison, WI) according to specifications of the manufacturer. Two pairs of modified PCR primers (forward primer GTTCTACATATGGCTGTCACGGGAGTT and reverse primer TTAAAGGTCAAGATAAAGTCAAAAAGCTT) were used to generate the complete open reading frame of the cementoin peptide from the obtained cDNA. The SLPI and cementoin cloned genes were amplified by PCR with modified primers, these primers created new recognition sites for restriction enzyme and an ATG (Met) translation initiation codon on the 5′ end. The plasmids, pGEMT-SLPI and PGEMT-cementoin were digested with the restriction enzimes ApaI and HindIII (Promega, Madison, WI) and cementoin and SLPI fragments were incubated together in equimolar amounts in a ligation reaction with the enzyme T4 DNA ligase (Promega). This insert was then ligated to the pET22b⁺expression vector (Stratagen).
The pET-Cementoin-SLPI vector was purified and electroporated in the E. coli expression strain Origami (Novagen, Inc., an Affiliate of Merck KGaA, Darmstadt, Germany). Origami host strains have mutations in both the thioredoxin reductase (trxB) and glutathione reductase (gor) genes, which greatly enhance disulfide bond formation in the cytoplasm.