S1000 thermal cycler

Total DNA was extracted from the blood of the mice (the 2 untreated mice from each strain) with a DNeasy Blood & Tissue kit (cat. no. 69504; Qiagen, Hilden, Germany) according to the manufacturer's instructions. The mouse PRNP gene was amplified using PCR in a Bio-Rad S1000 Thermal Cycler (Bio-Rad, Hercules, CA, USA). Two pairs of primers were used for better accuracy. The information of the primers was as follows: pair 1 forward, TCAGCCT AAATACTGGGCAC and reverse, AGATGAGGAGGATG ACAGGA; and pair 2 forward, GCCTAAATACTGGGC ACTGATAC and reverse, AGGAGATGAGGAGGATGACA; the size of both amplicons was 791 bp. The reaction mixtures consisted of a total of 50 µl, containing 1 µl DNA, 20 pmol sense and antisense primers, 21 µl RNase-free water and 25 µl 2X Taq Master Mix (CW0682; CWBio, Beijing, China). The touchdown method was adopted to increase the specificity of the PCR products. Details of the PCR conditions are as follows: denaturing at 94°C for 40 sec, annealing at 59°C for 45 sec with a decrease of 0.5°C every cycle in the first 8 cycles and 55°C for the other 30 cycles, and a final extension at 72°C for 55 sec. All PCR assays were carefully carried out in the PCR laboratory in four separate rooms to avoid DNA contamination.

The original pHis-parallel1 vector is a gift from S. L. McKnight’s research group at the Department of Biochemistry, University of Texas Southwestern Medical Center. The pHis-parallel1 vector contains two 6× His at both ends of the open reading frame. The TDP43 LC and Mfp5 genes were separately synthesized by GENEWIZ (Suzhou) and then amplified by polymerase chain reaction (PCR) with appropriate overhangs for Gibson assembly. TDP43 LC or recombinant gene TLC-M containing TDP43 LC and Mfp5 was cloned into pHis-parallel1 vectors using one-step isothermal Gibson assembly. The cleaved vector and corresponding PCR products were mixed together with the Gibson Assembly Master 2× Mix (New England BioLabs) at 50°C for 1 hour and then transformed into DH5α Escherichia coli competent cells. PCR amplifications were carried out with primer oligos purchased from GENEWIZ. A Bio-Rad S1000 thermal cycler with dual 48/48 fast reaction modules (Bio-Rad) was used to perform PCR, ligations, and Gibson assembly. Gel extractions were carried out with QIAquick Gel Extraction Kits (QIAGEN). All constructs were sequence-verified by GENEWIZ.

At 3 days of reperfusion, rats were anesthetized with an intraperitoneal injection of sodium pentobarbital 3% (w/v) at a dose of 40 mg/kg. The brains were removed and the cortices were dissected. Total RNA was isolated using TRIZOL reagent. cDNA was synthesized from each RNA using a random primer and RevertAid™ M-MuLV reverse transcriptase (Fermentas), according to the manufacturer's instructions. The obtained cDNA was used to determine the amount of Bcl-2 and Bax mRNA using PCR with Taq DNA polymerase (Fermentas). The primers used for amplification of the Bcl-2 and Bax transcripts were as follows: Bcl-2 forward, 5′-CCG GGA GAT CGT GAT GAA GT-3′ and reverse, 5′-ATC CCA GCC TCC GTT ATC CT-3′, product size 600 bp; Bax forward, 5′-CCA AGA AGC TGA GCG AGT GTC-3′ and reverse, 5′-TGA GGA CTCCAG CCA CAA AGA-3′; product size was 400 bp. PCR was performed in a final volume of 25 μL, containing 12.5 μL 2 × PCR master mix, 2 μL cDNA, 1 μL forward primer, 1 μL reverse primer, and 8.5 μL sterilized DEPC water. PCR was conducted in a Bio-Rad S1000 Thermal Cycler (Bio-Rad, Hercules, CA, USA), with the amplification condition of 94°C for 45 seconds, followed by 55°C for 60 seconds and then 72°C for 45 seconds, for 30 cycles. The amplification products were analyzed with 1.6% agarose gel electrophoresis and observed with a gel imaging system (Bio-Rad).

Architect i2000 automatic chemiluminescence immunoassay instrument, kits for the detection of HBsAg, anti-HBs, HBeAg, anti-HBe, and anti-HBc (Abbott Laboratories, Lake Bluff, IL), ABI stepone plus real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA), NP968 nucleic acid extraction system, nucleic acid extraction kit (Tianlong Biotechnology Co., Ltd., Suzhou, China), anti-HBs (1000 IU/mL) for HBsAg test, HBV DNA Fluorescence Quantitative Detection Kit [ACON Biotech (Hangzhou) Co., Ltd., Hangzhou, China], BIO-RAD S1000 thermal cycler (Bio-Rad Laboratories, Inc., Hercules, CA), and ABI PRISM BigDye sequencing Kit and ABI 3730 Genetic Analyzer (ABI Applied Biosystems, Foster City, CA) were used in the present study.