DNA was extracted by the potassium acetate method (Dellaporta et al. 1983 ). MFT was genotyped by the methods of Chono et al. (2015) (link) and Kato et al. (2017) (link), using a cleaved amplified polymorphic sequence (CAPS) marker (Chono et al. 2015 (link)). DNA templates were amplified with ExTaq DNA polymerase (TaKaRa, Shiga, Japan) and an MFT primer set (Chono et al. 2015 (link)) under conditions described in Kato et al. (2017) (link). The PCR fragments were digested by ClaI at 37°C for 1 h, separated by agarose gel electrophoresis, and visualized with Gel Red stain (Biotium, Fremont, CA, USA). ABA8ʹOH1-A was genotyped by the method of Chono et al. (2013) (link) with slight modifications. DNA templates were amplified with the S2A2 primer set (Chono et al. 2013 (link)) in a total volume of 10 μL containing 100 ng of genomic DNA, 200 μM each dNTP, 0.2 μM each primer, 0.25 U of ExTaqHS DNA polymerase (TaKaRa), and ExTaq buffer (TaKaRa). The amplification conditions used an initial denaturation at 94°C for 1 min; 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s; and a final extension at 72°C for 5 min. The PCR fragments were separated by polyacrylamide gel electrophoresis and visualized with Gel Red stain (Biotium).
Gelred stain
Manufactured by Biotium
Sourced in United States
GelRed stain is a fluorescent nucleic acid stain used for detecting DNA and RNA in agarose gels. It is a sensitive and stable alternative to ethidium bromide for gel electrophoresis applications.
Automatically generated - may contain errors
Lab products found in correlation
Genejet whole blood genomic dna purification kit, by Thermo Fisher Scientific (2 mentions)
Tbe polyacrylamide gel, by Thermo Fisher Scientific (2 mentions)
Realplex mastercycler 2, by Eppendorf (2 mentions)
Dmem f12, by Biowest (2 mentions)
Hot start dna polymerase, by Promega (2 mentions)
Dimethyl sulfoxide (dmso), by Avantor (2 mentions)
Instagene kit, by Bio-Rad (1 mentions)
Gotaq flexi polymerase, by Promega (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Ex taq hs dna polymerase, by Takara Bio (1 mentions)
Ex taq dna polymerase, by Takara Bio (1 mentions)
Ex taq buffer, by Takara Bio (1 mentions)
Resazurin, by Merck Group (1 mentions)
Endothelial cell growth supplement (ecgs), by Merck Group (1 mentions)
Penicillin streptomycin, by Merck Group (1 mentions)
Gelatin, by Serva Electrophoresis (1 mentions)
Rpmi 1640, by Biowest (1 mentions)
Methyl thiazolyl tetrazolium (mtt), by Merck Group (1 mentions)
Fetal bovine serum (fbs), by Merck Group (1 mentions)
Triton x 100, by Merck Group (1 mentions)
25 protocols using gelred stain
1
Genotyping DNA Markers in Plant Samples
2
ERIC-PCR for Variant Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ERIC-PCR was used to compare the patterns observed for the variants and their parental strain to ensure that the different collected variants were not due to contamination as previously described (Cuzin et al., 2021 (link)). DNA was first extracted using an InstaGene kit (Bio-rad, Marnes-la-Coquette, France) and amplified using a LightCycler® 480 thermocycler (Roche Diagnostics, Meylan, France) with primers ERIC1-R (ATGTAAGCTCCTGGGGATTCAC) and ERIC2 (AAGTAAGTGACTGGGGTGAGCG) and GoTaq Flexi polymerase (Promega, Charbonnières-les-bains, France) as follows: 95 °CC for 2 min for initial melting; 30 cycles at 95 °CC for 1 min, 54 °CC for 1 min, 72 °CC for 4 min; final extension at 72 °CC for 8 min followed by incubation at 4 °CC. PCR products were then checked on 1% agarose gel and migrated over 90 min at 110 V before being revealed using a GelRED stain (Biotium, Brumath, France).
3
Genotypic Sex Determination in Sablefish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For determination of genotypic sex in sablefish, PCR assays were conducted that targeted the X-insert in the gsdf promoter (Rondeau et al. 2013 (link); Luckenbach et al. 2017 (link)). To demonstrate that the gsdfX and gsdfY alleles were in accordance with phenotypic sex, PCRs were developed targeting chromosome-specific inserts in the regions upstream of gsdf (Supplemental Table S1 ). Primer pairs amplified sequences upstream of and into target X and Y inserts. As a positive control, an upstream sequence common to both gsdf paralogs was also amplified. PCR products were resolved on a 1.5% agarose gel with GelRed stain (Biotium).
4
Chemosensory Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was generated with input of 1 μg of total RNA using the RevertAid Minus H first strand cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's protocol. PCR assays were performed, with the Dream Taq Green master mix system (Thermo Fisher Scientific), on cDNA from single biological samples of virgin male and female antennae, proboscis and brain. Specific primer pairs (Additional file 22 ) were used for each chemosensory gene and the ribosomal protein, rpL8, was used as a positive control. For all PCR assays, thermocycling conditions were used for 35 cycles of: 30s at 95°C, 30s at 55°C and 1m at 72°C. PCR reactions were loaded on 1.5% agarose gels loaded with Gel Red stain (Biotium Inc., Fremont, CA, USA), and after electrophoresis, were visualized under UV light. Template-free and No-RT negative controls were also included for each primer pair and tissue type, respectively. Additional files are included for uncropped gels with experimental assays and no template controls (Additional file 23 ) and NORT assays (Additional file 24 ).
5
Genotyping VDBP Alleles by RFLP
6
Protocols for HBEC-5i Cell Line Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HBEC-5i cell line was purchased from ATCC (Manassas, VA, USA). DMEM-F12 and RPMI-1640 were acquired from Biowest, Nuaillé, France. Other reagents used in cell cultures (ECGS, 1% Penicillin-Streptomycin, FBS, MTT, Resazurin, Triton X-100) were purchased from Sigma-Aldrich, Saint Louis, MO, USA. DMSO used in the MTT assay was purchased from Avantor, Radnor, PA, USA. CyQUANT™ LDH Cytotoxicity Assay kit was acquired from InvitrogenTM Thermo Fisher Scientific, Waltham, MA, USA. Gelatin was obtained from Serva, Heidelberg, Germany. PBS used in experiments was prepared from tablets acquired from GibcoTM, Thermo Fisher Scientific, Waltham, MA, USA. While preparing gel electrophoresis, agarose from Maximus, Łódź, Poland and GelRed stain purchased from Biotium, Inc., Fremont, CA, USA, was used.
7
TREM2 Variant rs75932628-T Screening
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine that the autopsy cases used in this study did not carry the TREM2 gene variant rs75932628‐T, we used a polymerase chain reaction (PCR) method developed in‐house for screening a large series of DNA samples derived from human post‐mortem cases. Approximately 0.5 μg of DNA derived from cerebellum was amplified using the following primers (5P) GAAGGACAGCAGCCACAAG and (3P) GAGCCCACAACACCACAG to produce a fragment of 172 base pairs (bp). PCR was carried out using Promega Hot Start DNA polymerase in a reaction mixture of 1x Promega Green Buffer (Madison, WI, USA), primers (0.5 μM), deoxynucleotides (0.2 μM), MgCl2 (1.5 mM), DNA polymerase (0.125 units/reaction) and 5% dimethyl sulfoxide (DMSO). PCR amplification involved 35 cycles of 94°C for 30 s, 58°C for 30 s and 72°C for 1 minute after a 2‐minute step at 94°C to activate the enzyme. The DNA product was digested with the restriction enzyme HhaI (New England Biolabs, Ipswich, MA, USA). The change from C to T in this polymorphism resulted in loss of the HhaI restriction enzyme site. Digested DNA fragments were separated through 8% polyacrylamide gel and imaged after staining using Gel Red stain (Biotium, Hayward, CA, USA). A representative gel showing the patterns of the different genotypes of rs75932628‐T is shown in Figure 1 .
8
Stability and Protective Efficacy of siRNA-AgNP Complexes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Complexes of siRNA (1.5 μM) and AgNPs in different dendron:siRNA molar ratios were prepared in 10 mM phosphate buffer, pH 7.4, and incubated for 20 min at room temperature. Then the samples were placed on 3% agarose gel containing GelRed stain (Biotium, Fremont, CA, USA) and separated by electrophoresis in Tris-acetate-EDTA (TAE) buffer for 45 min at 90 V/35 mA. The gel was subsequently visualized using UV light and a digital picture of the stained gel was taken with UVP ChemiDoc-It2™ Imager (Thermo Fisher Scientific, Waltham, MA, USA).
To study the protection of siRNA against enzymatic degradation as a result of complexation with AgNPs, the complexes in dendron:siRNA molar ratios of 55:1, 12.5:1, and 7.5:1 were prepared for 1Ag, 2Ag, and 3Ag, respectively. The samples were incubated with RNase A/T1 (Thermo Fisher Scientific, Waltham, MA, USA, 10 μg/mL) for 30 min at 37 °C and 10 min on ice. Heparin (Sigma Aldrich, St. Louis, MO, USA, 0.082 mg/mL) was added to the samples for 10 min to release siRNA from the complexes. Samples prepared in this way were analyzed by electrophoresis in a manner analogous to that described above.
Band intensities were quantified digitally using ImageJ software and presented as mean ± SD, n = 3.
To study the protection of siRNA against enzymatic degradation as a result of complexation with AgNPs, the complexes in dendron:siRNA molar ratios of 55:1, 12.5:1, and 7.5:1 were prepared for 1Ag, 2Ag, and 3Ag, respectively. The samples were incubated with RNase A/T1 (Thermo Fisher Scientific, Waltham, MA, USA, 10 μg/mL) for 30 min at 37 °C and 10 min on ice. Heparin (Sigma Aldrich, St. Louis, MO, USA, 0.082 mg/mL) was added to the samples for 10 min to release siRNA from the complexes. Samples prepared in this way were analyzed by electrophoresis in a manner analogous to that described above.
Band intensities were quantified digitally using ImageJ software and presented as mean ± SD, n = 3.
9
Gel Electrophoresis Protocol for Nucleic Acid Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Constructs were run in 0.8% agarose gels, cast from molecular biology grade agarose (Fisher BioReagents) dissolved in 0.5× Tris-borate EDTA (TBE) (Ultra pure grade, Amresco). Samples were mixed with a Ficoll-based loading solution. Gels were typically run at 75 V (constant voltage) at room temperature. Gels were pre-stained by mixing 1× GelRed stain (Biotium) with the gel solution before the gel was cast. Gels were imaged with a Bio-Rad Gel Doc XR+ gel imager and analyzed using the gel analysis tool in the Image Lab software package available with Bio-Rad Gel Doc XR+. For the Hello World → Good Bye multi-bit rewriting experiment, gels were run at 100 V (constant voltage) and imaged using a Typhoon 9400 variable mode imager (GE Healthcare). Image analysis was done using the software ImageJ (https://imagej.nih.gov/ij/ ). Median filter in ImageJ was used to remove noise in gel images in Figures 2D , 3F and 4A –B .
10
Genotyping CD33 rs3865444 Polymorphism
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!