Blasticidin s

The expression plasmid pEF6/V5-His-KIF7-CC was generated by subcloning KIF7-CC from pCR-BluntII-TOPO-KIF7 (Imagenes) into pEF6/V5-His-TOPO (Invitrogen, Carlsbad, CA). PC3, C4-2B and 22Rv1 cells were transfected with pEF6/V5-His-KIF7-CC or the control vector using lipofectamine 2000 (Invitrogen, Carlsbad, CA). Stable clones were selected by blasticidin S (10 μg/ml, sigma).
The KIF7-MD was cloned into a pCDH-CMV-MCS-EF1-copGFP vector (System Biosciences, Mountain View, CA). PC3 and C4-2B cells were transduced with lentivirus packaged with either a KIF7-MD-expressing vector or an empty vector to generate KIF7-MD-overexpressing (MD) or control cells (GFP) using a Lenti Starter kit (SBI, Mountain View, CA). GFP-positive cells were selected by fluorescence-activated cell sorting using BD Aria (BD Biosciences).

Blood-stage P. falciparum strain 3D7 was cultured continuously (Trager and Jensen, 1976 (link)) and transfected as previously described (Fidock and Wellems, 1997 (link)). Transgenic parasites were selected with 2.5 nM WR99210 (Jacobus) or 5 μg/mL blasticidin S (Sigma-Aldrich, Australia). P. berghei transgenic parasites were generated using the reference clone 15cy1 from the P. berghei ANKA strain. Transfection of parasites and selection of the transgenic parasites intravenously injected into 6- to 8-week-old female BALB/c mice was performed as previously described (Janse et al., 2006 (link)).

100 ng Firefly luciferase mRNA was added to rabbit reticulocyte lysate (RRL) (Green Hectares, Wisconsin, USA) in a reaction volume of 10 μl, as described previously (26 (link)). Blasticidin S (Sigma-Aldrich, #15205) was added simultaneously, and the in vitro translation reactions were incubated at 30°C for 30 min. Reactions were stopped by the addition of 30 μl of 1× lysis buffer from the luciferase assay kit (Promega, #E1500). The luciferase activity was detected following the manufacturer's protocol using a Synergy Neo2 plate reader (BioTek, Vermont, USA).

NPCs were transduced with lentiviral vectors (pMD2.G and psPAX2) containing CRISPR/Cas9 constructs to knockdown (KO) ZMPSTE24 (KO1: ACCAGAGTTA GAACAGATCATGG, KO2: CTGGTCAGGACTCTA TTCAGAGG, KO3: GGAGAAGCGAATCTTCGGGG CGG) or a scrambled control. For ZMPSTE24 knockdown, cells were selected in 5 μg/mL blasticidin S (Yeasen, 60218ES10, China) for 48 h and maintained thereafter in 2.5 μg/mL blasticidin S. For ZMPSTE24 overexpression (OE), the cells were selected in 3 μg/mL puromycin (Sigma-Aldrich) for 48 h and maintained thereafter in 1 μg/mL puromycin. In both cases, selection antibiotics were first applied 72 h after transduction. Western blotting was used to confirm KO and OE efficiency.

Cells expressing the protein of interest were selected by growth in the presence of 20 μg/ml geneticin (Sigma, Steinheim, Germany) or 10 µg/ml blasticidin S, and/or hygromycin (Sigma, Steinheim, Germany) with the requirement of double selection. For differentiation, log-phase vegetative cells were harvested from shaking culture (5×10⁶ cells/ml) and washed twice with developmental buffer (DB: 5 mM Na₂HPO₄, 5 mM KH₂PO₄, 2 mM MgSO₄, and 0.2 mM CaCl₂) before the experiments.

HEK293 cells, stably expressing hSloα1 [24 (link)], were cultured in Dulbecco's modified Eagle Media supplemented with 10% (v/v) foetal bovine serum, non-essential amino acids, 5 µg/ml Blasticidin S (Sigma), 100 U/ml penicillin and 100 mg/ml streptomycin. HEK293 cells, stably expressing hSloβ1 in addition to hSloα1 were grown as above, with the addition of 1 mg/ml Geneticin (Sigma) [24 (link)]. Cells were harvested at confluency from triple layered T175 flasks using non-enzymatic cell dissociation media.
Cells were pelleted by centrifugation (1000g, 10 min, 4°C) and resuspended in buffer 1 (50 mM Tris, pH 7.4, 250 mM sucrose and 0.25 mM CaCl₂) supplemented with protease inhibitors (1 µM pepstatin, 1.3 µM benzamidine and 1.8 µM leupeptin). Cells were lysed by nitrogen cavitation (500 psi, 15 min, 4°C) and cell debris removed by low-speed centrifugation (750g, 20 min, 4°C). Membranes were harvested by ultracentrifugation (100 000g, 20 min, 4°C), and resuspended in buffer 2 (20 mM Tris pH 8 and 150 mM NaCl) at 60 mg/ml (wet pellet weight). Aliquots were stored at −80°C for up to 6 mo.