DNA was extracted from the filtered membranes containing dinoflagellates and microbial cells using a DNeasy PowerSoil Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. The amount of double-stranded DNA and the purity in the extracted DNA samples was measured by PicoGreen (Promega, Madison, WI, USA) using VICTOR Nivo (PerkinElmer, Waltham, MA, USA). Per the Illumina 16S Metagenomic Sequencing Library protocols, the V3-V4 region of 18S ribosomal DNA (rDNA) gene in each sample was amplified by PCR using the following primers: 18S amplicon PCR forward primer, 5′–TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCAGCASCYGC GGTAATTCC-3′, reverse primer, 5′–GTCTCGTGGGCTCGGAGATGTGTATAAG -AGACAGACTTTCGTTCTTGATYRA-3′ [25 (link)]. A subsequent amplification step with limited-cycle reaction was performed to add multiplexing indices and Illumina sequencing adapters. The PCR products were pooled, cleaned, and normalized using the PicoGreen, and the size of libraries was measured using a TapeStation DNA screen tape D1000 (Agilent Technologies, Santa Clara, CA, USA). Sequence libraries in the sample were verified using the MiSeq™ platform (Illumina, San Diego, CA, USA).
Picogreen
Manufactured by Promega
Sourced in United States
PicoGreen is a fluorescent nucleic acid stain used for the quantitation of double-stranded DNA (dsDNA) in solution. It is a highly sensitive dye that binds to dsDNA, allowing for the accurate measurement of DNA concentrations in a wide range of sample types.
Automatically generated - may contain errors
Lab products found in correlation
Tapestation dna screentape d1000, by Agilent Technologies (4 mentions)
Miseq platform, by Illumina (4 mentions)
Victor nivo, by PerkinElmer (3 mentions)
16s metagenomic sequencing library protocol, by Illumina (2 mentions)
Dneasy powersoil kit, by Qiagen (2 mentions)
Miseq reagent kit v2, by Illumina (2 mentions)
Basespace, by Illumina (2 mentions)
Synergy ht, by Agilent Technologies (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (2 mentions)
Picogreen, by Agilent Technologies (1 mentions)
Powersoil dna extraction kit, by Qiagen (1 mentions)
16s metagenomic sequencing library preparation, by Illumina (1 mentions)
Proteinase k, by Thermo Fisher Scientific (1 mentions)
Glycoblue, by Thermo Fisher Scientific (1 mentions)
Rnase a, by Thermo Fisher Scientific (1 mentions)
Quantiflour, by Promega (1 mentions)
Allprep micro kit, by Qiagen (1 mentions)
Infinite m200 pro, by Tecan (1 mentions)
15 protocols using picogreen
1
Characterizing Dinoflagellate Microbiome via 18S rDNA
2
Soil DNA Extraction and PCR Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In total, 0.5 g of soil stored in a refrigerator at −80 °C was taken, and total DNA of the soil was extracted using the PowerSoil® DNA extraction kit (MoBio Laboratories, Inc., Carlsbad, CA, USA), according to the manufacturer’s instructions. DNA content was quantified using a NanoDrop spectrophotometer (ND-2000, Thermo Scientific, Waltham, MA, USA), diluted to 10 ng·μ L−1, and stored in a refrigerator at −20 °C util use. Each DNA sample had 9 PCR repeats and included 2 negative controls without DNA template. The PCR reaction system and reaction procedure were based on the method described by Zhao et al. [18 (link)]. The PCR product was purified through gel cutting, and the concentration was determined using PicoGreen® (Promega, Madison, WI, USA). After equimolar mixing, the product was sent to Guangdong MAGIGENE Technology limited company for sequencing.
3
Fecal Microbiome Profiling via 16S Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fecal samples were collected and frozen within 3 days of the visit date in a sterile stool collection kit provided by Macrogen (Seoul, South Korea). DNA from fecal samples was extracted using the DNeasy PowerSoil Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol, and the amount and quality were measured by PicoGreen (Promega, Madison, WI, USA) using VICTOR Nivo (PerkinElmer, Waltham, MA, USA). For 16S rDNA sequencing, fecal samples were prepared according to the Illumina 16S Metagenomic Sequencing Library Preparation protocols (Illumina, San Diego, CA, USA) as follows. The 16S rRNA genes were amplified from genomic DNA using 16S primers V3–V4. A subsequent limited‐cycle amplification step was performed to add multiplexing indices and Illumina sequencing adapters. The final products were normalized and pooled using PicoGreen. The sizes of libraries were verified using the TapeStation DNA screentape D1000 (Agilent Technologies, Santa Clara, CA, USA) and sequenced using the Illumina MiSeq platform.
4
Purification and Quantification of DNA from Diverse Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA from the input, IPOD-HR, and ChIP fractions described above was recovered using identical procedures: Samples diluted in elution buffer (see above) were incubated overnight (6 to 16 hours) at 65°C to reverse formaldehyde cross-links. After allowing the samples to cool to room temperature, we then added 100 μg of RNase A (Thermo Fisher Scientific), incubated 2 hours at 37°C, then added 200 μg of proteinase K (Fermentas, subsidiary of Thermo Fisher Scientific, Waltham, MA) and incubated an additional 2 hours at 50°C. DNA was then recovered via standard phenol–chloroform extraction and ethanol precipitation, following protocols from [57 ]. We used Glycoblue (Ambion, subsidiary of Thermo Fisher Scientific, Waltham, MA) as a coprecipitant, NaCl as a precipitating salt (due to the presence of SDS in our solution), and washed with ice-cold 95% ethanol to avoid loss of low molecular weight DNA.
Recovered DNA was quantified via fluorescent quantitation (using either the Invitrogen PicoGreen or Promega (Madison, WI) QuantIT system), and samples of sufficiently high concentration were also run on a 2% agarose gel for fragment size assessment. Typical total yields from the procedure above were on the order of 1 μg of DNA for the input samples, 100 to 200 ng for the IPOD-HR samples, and 1 to 10 ng for the ChIP samples.
Recovered DNA was quantified via fluorescent quantitation (using either the Invitrogen PicoGreen or Promega (Madison, WI) QuantIT system), and samples of sufficiently high concentration were also run on a 2% agarose gel for fragment size assessment. Typical total yields from the procedure above were on the order of 1 μg of DNA for the input samples, 100 to 200 ng for the IPOD-HR samples, and 1 to 10 ng for the ChIP samples.
5
Thyroid FNA Sample Extraction and QC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA and DNA were extracted from thyroid FNAs or control tissues (described below under Cohorts and Controls, respectively) using the Qiagen AllPrep Micro Kit (Qiagen, Hilden, Germany) according to manufacturer's instructions. RNA was quantitated using Quantiflour (Promega, Madison, WI) and DNA was quantitated using PicoGreen (Promega, Madison, WI). Fluorescence was read on a Tecan Infinite M200 Pro (Tecan, Männedorf, Switzerland). RNA Integrity Number (RIN) was determined for RNA using RNA Pico Chips on the Bioanalyzer 2100 (Agilent, Santa Clara, CA).
6
DNA Quantification for Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA extracts were qualified and quantified on a NanoDrop ND-1000 spectrophotometer (NanoDrop® Technologies, Wilmington, DE, USA). In addition, DNA concentration was also quantified by PicoGreen (Promega, Sunnyvale, CA, USA) (Ahn, Costa & Emanuel, 1996 (link)) on a FLUOstar OPTIMA plate reader (BMG Labtech, Jena, Germany), and the template DNA was diluted to 2 ng μL−1 with nuclease-free water (Ambion, Austin, TX, USA).
7
Genome Sequencing of Lactococcus garvieae Lg-Granada
Check if the same lab product or an alternative is used in the 5 most similar protocols
L. garvieae
The strain was cultured using log-phase cultures (OD600, ~1) in BHI (Panreac AppliChem), and DNA was extracted using the Blood and Cell Culture DNA Maxi Kit (Qiagen) according to the manufacturer’s specifications. Quality control was assessed and concentration of the DNA was measured by both photometric (NanoDrop; Thermo Fisher Scientific) and fluorometric (PicoGreen; Promega) methods. The DNA had a good quality, with a 260/280 ratio of 1.8, a 260/230 ratio of 2.2 and a concentration of 462.6 ng µl−1.
The genomic DNA was sheared and size selected to produce ~15–25 kb insert-size libraries using BluePippin (Sage Science) according to the manufacturer’s size-selection system protocol. The selected fragments were sequenced on a PacBio RS II platform (Pacific Biosciences) using a P6-C4 polymerase-chemistry combination, and data acquisition time of ≥4 h.
+ Expand
The strain was cultured using log-phase cultures (OD600, ~1) in BHI (Panreac AppliChem), and DNA was extracted using the Blood and Cell Culture DNA Maxi Kit (Qiagen) according to the manufacturer’s specifications. Quality control was assessed and concentration of the DNA was measured by both photometric (NanoDrop; Thermo Fisher Scientific) and fluorometric (PicoGreen; Promega) methods. The DNA had a good quality, with a 260/280 ratio of 1.8, a 260/230 ratio of 2.2 and a concentration of 462.6 ng µl−1.
The genomic DNA was sheared and size selected to produce ~15–25 kb insert-size libraries using BluePippin (Sage Science) according to the manufacturer’s size-selection system protocol. The selected fragments were sequenced on a PacBio RS II platform (Pacific Biosciences) using a P6-C4 polymerase-chemistry combination, and data acquisition time of ≥4 h.
8
Targeted NGS Amplicon Sequencing Protocol
9
Quantification and Visualization of NET DNA Release
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
(a) Quantitation of DNA release: Neutrophils (5 × 105/500 µL media containing 2% (v/v) FBS) were seeded into wells of a 24-well culture and incubated for 1 h at 37 °C. APPA (100 µg/mL) was then added and incubated for 10 min before stimulation with 100nM PMA for 3 h at 37 °C. After incubation, NET DNA was isolated using Micrococcal nuclease (500 mU, Sigma) and quantified utilizing picogreen (Promega) and a DNA calibration curve. (b) microscopic visualisation: neutrophils were seeded and incubated as described above. Following incubation cells were fixed on cover slips, stained with neutrophil elastase antibody and DAPI (Thermo-Fisher) before being viewed microscopically on a Leica TCS SPE (Papayannopoulos et al. 2010 (link)).
10
Targeted NGS Amplicon Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Next-generation sequencing (NGS) of DNA targeted amplicons was performed as previously described7 (link). In summary, the first PCR amplified the genomic site of interest with primers containing Illumina adapter sequences (Supplementary Table 9 ), and the second PCR added barcodes with primers containing unique pairs of p5/p7 Illumina barcodes that are analogous to TruSeq CD indexes. The libraries were pooled based on Pico Green (Promega) measurements on a BioTek Synergy HT plate reader, and the final pool was sequenced paired-end (PE) 2×150 on a MiSeq machine using 300-cycle MiSeq Reagent Kit v2 (Illumina). Demultiplexed FASTQs were downloaded from Basespace (illumina) and analyzed using the batch version of CRISPResso216 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!