Sybr green pcr technology

Total RNA was extracted with Trizol Reagent (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. First strand cDNA was synthesized according to the manufacturer’s instructions (Bio-Rad, Hercules, CA, USA). Quantitative PCR analysis was performed with SYBR green PCR technology (Bio-Rad). The following primers were used: IL-6 (F: AGTTCCTGCAGAAAAAGGCAAAG, R: CATTTGCCGAAGAGCCCTCA); decorin (F: CCTGATGACCGCGACTTCGAG, R: TTTGGCACTTTGTCCAGACCC); biglycan (F: TCTGTCACACCCACCTACAGC, R: AGGGGAGATCTCTTTGGGCAC); lumican (F: TGAGCTGGATCTGTCCTATAA, R: ATCTTGCAGAAGCTCTTTATG), MMP-1 (F: ACATGAGTCTTTGCCGGAGG, R: AACAAGGTTGACTTTATTCCAAACA), TIMP-1 (F: GGAATGCACAGTGTTTCCCTG, R: GGAAGCCCTTTTCAGAGCCT), MMP-2 (F: CGACCACAGCCAACTACGAT, R: GTCAGGAGAGGCCCCATAGA), TIMP-2 (F: GCTGCGAGTGCAAGATCACG, R: AGAGCTGGACCAGTCGAAAC. Relative quantification was achieved with MyiQ software. Data were normalized by HPRT, GADPH and β-actin levels and expressed as percentage relative to controls. All PCRs were performed at least in triplicate for each experimental condition.

Total RNA was extracted with Trizol Reagent (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. First strand cDNA was synthesized according to the manufacturer’s instructions (Bio-Rad, Hercules, CA, USA). Quantitative PCR analysis was performed with SYBR green PCR technology (Bio-Rad). The following primers were used: MR (F:CCCAACAATTCTGGGCAGAGC, R:ACTCTACCTTCAGCGCAT); 11HSD2 (F:AGAAGCTGCAACAGGTGAC, R:GCGACAGCACTTCTGGATT); h18S (F:GCAATTATTCCCCATGAACG, R:GGGACTTAATCAAGCAAGC); beta-actin (F:GCAAGCAGGAGTATGACGAG, R:CAAATAAAGCCATGCCAATC); GAPDH (F:CAATGACCCCTTCATTGACC; R:GACAAGCTTCCCGTTCTCAG). Quantification of relative gene expression was performed using the AACt method. Data were normalized by h18S and β-actin levels and expressed as a percentage relative to controls. All PCRs were performed at least in triplicate for each experimental condition.

Total RNA from cells and AVs was extracted with Trizol Reagent (Canvas). First strand cDNA was synthesized according to the manufacturer's instructions (Bio-Rad). Quantitative PCR analysis was then performed with SYBR green PCR technology (Bio-Rad) (Supplementary Major Resource Table). Relative quantification was achieved with MyiQ (Bio-Rad) software according to the manufacturer's instructions. Data were normalized to18S, HPRT, β-actin and GADPH levels, and expressed as fold-change relative to women. All PCRs were performed at least in triplicate for each experimental condition. Results have been plotted as fold-change with women as calibrator or reference group.

Total RNA was extracted with Trizol Reagent (Euromedex) and purified using the RNeasy kit, according to the manufacturer’s instructions (Qiagen). Quantitative PCR analysis was then performed with SYBR green PCR technology (Bio-Rad) (Supplemental Table 1). Data were normalized by HPRT and β-actin levels or nuclear DNA and expressed as percentage relative to controls. All PCRs were performed at least in triplicate for each experimental condition.

Total RNA was isolated using Trizol Reagent (Fisher Scientific, Waltham, MA, USA) and was reverse-transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific Inc, Waltham, MA, USA). Quantitative PCR analysis was performed with SYBR green PCR technology (Bio-Rad, Hercules, CA, USA) and specific oligonucleotides (Table S1). Quantification of mRNA levels was performed by real-time PCR using the ΔΔCt method. Data were normalized to hypoxanthine phosphoribosyltransferase (HPRT).

Total RNA from VICs and AVs (N = 155) was extracted with Trizol Reagent (Canvas). First strand cDNA was synthesized according to the manufacturer’s instructions (Bio-Rad). Quantitative PCR analyses were performed using SYBR green PCR technology (Bio-Rad). Relative quantification was achieved with MyiQ (Bio-Rad) software according to the manufacturer’s instructions. Data were normalized to 18 S, HPRT, ACTB and GADPH levels, and expressed as fold-change relative to men. All PCRs were performed at least in triplicate for each experimental condition. Primers sequences used have been previously reported [16 ].