The largest database of trusted experimental protocols

One glo luciferase assay reagent

Manufactured by Promega
Sourced in United States

ONE-Glo luciferase assay reagent is a luminescent reporter assay that measures the activity of firefly luciferase. It is used for the quantitative detection of luciferase expression in cell-based assays.

Automatically generated - may contain errors

24 protocols using one glo luciferase assay reagent

1

High-Throughput Screening for Nuclear Receptor Modulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
FXR-bla HEK293 cells, components of individual thaw media, growth media, assay media, beta-lactamase assay reagents, and coactivator assays for CAR, FXR, and LXRα were purchased from Life Technologies (Carlsbad, CA, USA). CAR-luc cells were generated as described previously (Lynch et al., 2015 (link)). LXRα-luc and PXR-luc assays were acquired from Indigo Biosciences (State College, PA, USA) and Puracyp (Carlsbad, CA, USA), respectively. Compound solutions were prepared from NCATS’ in-house compound collections (e.g., Tox21 10K library). Powder compounds were purchased from SelleckChem (Houston, TX, USA) and Sigma-Aldrich (St. Louise, MO, USA) and sample quality control (QC) analysis was measured on Agilent LC/UV/MS system (Santa Clara, CA, USA) using a standard gradient of 4-100% acetonitrile in the presence of 0.05% trifluoroacetic acid over seven minutes on a 3 micron Luna C18 (3×75 mm) column. All 1536-well compound storage and assay plates were obtained from Greiner Bio One USA (Monroe, NC, USA). CellTiter-Fluor cell viability, CellTiter-Glo cell viability, and One-Glo luciferase assay reagents were acquired from Promega (Madison, WI, USA).
+ Open protocol
+ Expand
2

Luciferase reporter assay for transcription factor activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
Luciferase reporter constructs were transfected into Hela cells as previously described [26 (link)]. Pathways, targets, and inducers included Stat3 (TGCTTCCCGAATTCCCGAATTCCCGAATTCCCGAATTCCCGAATTCCCGAACGT) induced by IL6 (50 ng/ml, R&D Systems 206-IL-010) [26 (link)] and.
NFkB (GCTACAAGGGACTTTCCGCTGGGGACTTTCCAGG) induced by PMA [26 (link),27 (link)]. Twenty four hours after transfection, cells were incubated with pathway inducers for 30 min, treated with MASL for 4–6 h, lysed with One-Glo luciferase assay reagents (Promega), and luminescence was measured with a GloMax Multi + detection system equipped with Instinct Software (Promega). Values were normalized to untreated HeLa control cells.
+ Open protocol
+ Expand
3

Luciferase Reporter Assay for Pathway Induction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Luciferase reporter constructs were transfected into Hela cells as previously described26 (link). Pathways, targets, and inducers included Stat3 (TGCTTCCCGAATTCCCGAATTCCCGAATTCCCGAATTCCCGAATTCCCGAACGT) induced by IL6 (50ng/ml, R&D Systems 206-IL-010)26 (link) and NFkB (GCTACAAGGGACTTTCCGCTGGGGACTTTCCAGG) induced by PMA26 (link),27 (link). Twenty four hours after transfection, cells were incubated with pathway inducers for 30 minutes, treated with MASL for 4–6 hours, lysed with One-Glo luciferase assay reagents (Promega), and luminescence was measured with a GloMax Multi+ detection system equipped with Instinct Software (Promega). Values were normalized to untreated HeLa control cells.
+ Open protocol
+ Expand
4

Cotransfection of HeLa cells for luciferase assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
HeLa cells (7 × 104) were cotransfected in triplicate in a 96-well plate with 50 ng each of pGL4-BST2pro, lenti dCAS-VP64_Blast, lenti MS2-P65-HSF1_Hygro, and 100 ng of either pLV-sgR-BST2pro-Zeo or an empty vector control using the FuGENE6 transfection reagent (Promega) according to the manufacturer’s instructions. After 48 h, the cells were lysed in 100 μl of One-Glo Luciferase Assay Reagent (Promega). The firefly luciferase activity was determined with a Centro LB960 (Berthold) luminometer.
+ Open protocol
+ Expand
5

ADCC Reporter Assay for Antibody Potency

Check if the same lab product or an alternative is used in the 5 most similar protocols
ADCC reporter assay was performed using NK-92 NFAT-Luc reporter cell line as effector cells, and target cells. The effector:target cell ratio was 1:2. Briefly, the effector/target cell mixture was plated in a 96-well white-bottom assay plate at 100,000 cells per well, followed by incubation with serial dilutions of antibodies. After incubation at 37 °C for 3 h, ONE-Glo Luciferase Assay Reagent (Promega) was added and luminescence was determined using SpectraMax Paradigm. The reporter signals of samples and controls were plotted against the antibody concentrations. The dose–response curves were fitted with a four-parameter model using the GraphPad Prism 8.0. For comparison, relative potency and relative efficacy of test antibodies were calculated using the following formulas: ADCC activity=EC50 of control/EC50 of sample.
+ Open protocol
+ Expand
6

Quantifying NF-kB Signaling Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols
Nuclear factor-kappa B (NF-κB) β-lactamase and luciferase reporter assays were
performed as described previously.30 (link) NF-κB-bla cells or NF-kB-luc cells were dissociated with 0.05%
trypsin/EDTA, resuspended in assay medium, and dispensed at 2000 cells/5 μL/well
in a 1536-well black clear- or 2000 cells/4µL/well in a white solid-bottom plate
(Greiner Bio-One) using a BioRAPTR Flying Reagent Dispenser (FRD) (Beckman
Coulter, Pasadena, CA). Twenty-three nanoliters of compound was transferred to
the assay plate by a Wako Pintool station (Wako Automation). One microliter of
medium with or without 1 ng/mL TNF-α was dispensed by an FRD. After the plates
were incubated for 5 h at 37 °C, 1 μL of LiveBLAzer B/G FRET substrate (Thermo
Fisher) detection mixture and 5 μL of ONE-Glo luciferase assay reagent (Promega)
were added. The plates were incubated at RT for 2 h and 30 min, respectively,
and fluorescence intensity (405 nm excitation, 460 and 530 nm emissions) and
luminescence were measured by an Envision plate reader and a ViewLux plate
reader (PerkinElmer), respectively.
+ Open protocol
+ Expand
7

Luciferase Assay for Melanoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
FL-melanoma and ISRE/FL-melanoma cells were seeded into 12 well plates and incubated at 37°C in 5% CO2. Supernatants from either EGFP-ADSCs or IFNγ-ADSCs were added to these cells once they reached cell densities of 105 and 3 × 105 respectively. Two days later, a volume of ONE-Glo™ luciferase assay reagent (Promega Corp. Madison, WI) equal to that of the CM was added to each well and samples were mixed thoroughly. Luminescence imaging was performed in an imaging system (Bruker Inc, Ettlingen, Germany) using a UV-Epi-Illumination source with a 15 min exposure time.
+ Open protocol
+ Expand
8

Measuring Type I Interferon Induction in HEK Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK cells stably expressing firefly luciferase under the control of the human IFNB promoter (p125-HEK cells) have been described previously23 . Cells were seeded at 20,000 cells per well in a 96-well plate. The following day, cells were transfected with the indicated doses of RNA extracted from the lungs of mice complexed with 0.5 μl Lipofectamine 2000 (Thermo Fisher Scientific) per well. Activation of the IFNB promoter was assessed after 24 h using OneGlo luciferase assay reagent (Promega).
+ Open protocol
+ Expand
9

Pseudotyped Luciferase Reporter Virus Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate luciferase reporter viruses pseudotyped with either VSV-G or HIV-1-Env, 2.5 × 105 293T cells were transfected with either increasing amounts (0, 60, or 120 ng) of mammalian MARCH8 expression plasmids (WT, AxxL, and RING-CH mutants) or fixed amounts (100 ng) of MARCH8/MARCH3-chimeric expression plasmids, along with 20 ng of pC-VSVg or pC-NLenv, 500 ng of pNL-Luc2-IN/HiBiT-E(−)Fin, and an empty vector to reach a total DNA amount of 1 μg, using FuGENE6. Sixteen hours post-transfection, the cells were washed with PBS and incubated with 1 mL of fresh complete medium. After an additional 24 h, the supernatants containing the pseudotyped viruses were treated with 37.5 U/ mL of DNaseI (Roche Applied Science, Penzberg, Upper Bavaria, Germany) at 37 °C for 30 min. Viral supernatants were quantified using the HiBiT assay, as described previously [20 (link)]. The HiBiT-based luciferase activity in the viral supernatants was measured using a Centro LB960 luminometer (Berthold, Bad Wildbad, Baden-Württemberg, Germany) and converted into p24 antigen levels. To assess viral infectivity, 1 × 104 MAGIC5 cells were exposed to 1 ng of p24 antigen from the HIV-1 supernatants. After 48 h, the cells were lysed in 100 μL of One-Glo luciferase assay reagent (Promega), and firefly luciferase activity was quantified using a Centro LB960 luminometer.
+ Open protocol
+ Expand
10

MTT-Based Apoptosis and NF-κB Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
MTT [3- (4, 5-dimethylthiazol-2-yl)-2, 5-dipheny ltetrazolium bromide] was purchased from Alfa Aesar, Inc. (Lancashire, United Kingdom), reconstituted in PBS to 2 mg/mL and diluted with appropriate cell culture media before use. Lipofectamine 3000®, TNFα and ON-TARGETplus® non-targeting siRNAs were obtained from Life Technologies Inc (Carlsbad, CA, USA), Peprotech, (Rocky Hill, NJ, USA) and GE Dharmacon® (Little Chalfont, Buckinghamshire, UK) respectively. Annexin V-FITC apoptosis detection kit and Cellytic M® buffer were from Sigma-Aldrich (St. Louis, MO, USA). Pierce transcription factor assay kits for NF-κB p65/p50 and NE-PER® nuclear and cytoplasmic extraction reagents were from Thermo Scientific (Rockford, IL, USA). All antibodies were from Cell Signaling Technology Inc. (Danvers, MA, USA) except for anti-GADPH and anti-p50 (Ser337) antibody which were from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Product codes of primary antibodies are as follows: cleaved caspase-3 (#9664); Bcl-2 (#2872); Mcl1 (#4572); Bcl-xl (#BAX (#2772); survivin (#2803); p65 (#8242); p65 Ser536 (#3031); p105/50 (#3035); p50 Ser337 (sc-33022); IκBα (#4812); GAPDH (sc-48166). p50 or p65 siRNA were also from Santa Cruz. ONE-Glo™ Luciferase assay reagent was from Promega (Madison, WI, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!