Hybridization buffer

U2OS cells stably expressing SARS-CoV-2 N protein with a carboxyl-terminal Clover tag were a gift from the Cleveland lab at the University of California San Diego (UCSD). Cells were cultured in phenol-negative DMEM media supplemented with 10% FBS and 1% PS at 37°C with 5% CO₂. Prior to imaging, cells were transferred to glass-bottomed plates (Nunc Lab-Tek, 0.4 mL working volume) at approximately 25% confluence. Cells were transfected with a construct expressing N-MS2 RNA (the N cDNA sequence with 6 upstream stop codons and 3 carboxyl-terminal MS2 repeats) as described above. Cells were induced with doxycycline at a final concentration of 1,000 ng/mL and allowed to express for 14 hours. FISH was performed following the Stellaris RNA FISH protocol for adherent cells. Cells were fixed with 3.7% formaldehyde, permeabilized with 70% ethanol, and incubated in the dark at 37°C overnight with hybridization buffer (Biosearch Technologies, Middlesex, UK) supplemented with 10% deionized formamide and either 125 nM Cy3-(d)T20 oligonucleotides (Gene Link, Florida, USA) or 1 μM Cy3-MS2 probe (IDT (Iowa, USA), sequence AGGCAATTAGGTACCTTAGG) [19 (link)]. Cells were washed with wash buffer A (Biosearch Technologies, Middlesex, UK) for 30 minutes, then incubated with DRAQ5 1:1,000 in wash buffer A for 30 minutes and exchanged into wash buffer B (Biosearch Technologies) before imaging.

LNA GapmeR probes from QIAGEN were used. Sequence of RNA FISH probe targeting LINC00607 is listed in Supplementary Table 6. HUVEC cells were seeded onto poly-L-Lysine pre-coated coverslips and treated with mannitol or HG + TNFα for 3 days. Cells were washed twice in PBS and fixed in fresh 3.7% formaldehyde (pH 7.2) for 10 min. Cells were permeabilized in 70% ethanol at least overnight at 4 °C. Slides were incubated with 1 mL of wash buffer A at RT for 2–5 min. Then the slides were incubated with LNA-probes 1:100 dilute in the hybridization buffer (Biosearch Technologies). After 16 h of hybridization in a dark humid chamber at 37 °C, the slides were washed with wash buffer A (Biosearch Technologies) in the dark for 30 min. Following washes, the cells on the slides were stained with DRAQ5 (Abcam, AB108410, 1:1000 dilution) in dark for 30 min. The slides were incubated with wash buffer B (Biosearch Technologies) at RT for 2–5 min and were imaged on a Leica SP5 Confocal microscope using 63×/1.40 oil immersion objective lens. Fluorescent FISH signal was captured using Leica LAS AF software in 1024 × 1024 format. All images were taken using the same power, gain, and collection bands for respective fluorophores to allow equal comparison of fluorescence levels of samples.

For single-molecule RNA fluorescent in situ hybridization (smRNA-FISH), cells were grown in Ibidi eight-well glass-bottom plates (Ibidi 80827) (initial seeding, 10⁴ cells /well). On the day of analysis, cells were washed twice with DPBS, fixed in 4% PFA for 10 min at RT, and washed again twice with DPBS. Cells were then incubated in 70% ethanol at 4 °C for at least 1 hr and then washed with 1 ml of Wash Buffer A (LGC Biosearch Technologies) at room temperature for 5 min. Cells were subsequently hybridized with 100 μl of Hybridization Buffer (LGC Biosearch Technologies) containing the smRNA-FISH probes at a 1:100 dilution in a humid chamber at 37 °C o/n (not more than 16 h). The next day, cells were washed with 1 ml of Wash Buffer A at 37 °C for 30 min and stained with Wash Buffer A containing 10 μg/ml Hoechst 33342 at 37 °C for 30 min. Cells were then washed with 1 ml of Wash Buffer B (LGC Biosearch Technologies) at RT for 5 min, mounted with ProLong Gold (Thermo, P10144), and left to curate at 4 °C o/n before proceeding to image acquisition. Oligonucleotides probes were designed with the Stellaris smRNA-FISH probe designer (LGC Biosearch Technologies, version 4.2), labeled with Quasar 570 and produced by LGC Biosearch Technologies. smRNA-FISH probes sequences are listed in Supplementary file 3.