Log In Sign up
The largest database of trusted experimental protocols

Clone g46 2

Manufactured by BD
Visit Supplier

The Clone G46-2.6 is a laboratory equipment product manufactured by BD. It is designed for general laboratory use. The core function of the Clone G46-2.6 is to perform specific tasks and operations within a laboratory setting.

Automatically generated - may contain errors

Lab products found in correlation

Puromycin, by Merck Group (1 mentions) Dmem medium, by Merck Group (1 mentions) Clone l243, by BD (1 mentions) Anti hla dr pe, by BD (1 mentions) Anti cd86 pe cy7, by BD (1 mentions) Anti hla abc pe, by BD (1 mentions) Anti cd80 pe cy7, by BD (1 mentions) Anti cd123 apc, by Miltenyi Biotec (1 mentions) Anti cd11c apc, by Miltenyi Biotec (1 mentions)

Spelling variants of this product

G46-2.6 (5 citations) HLA-ABC (clone G46-2.6; (2 citations)

5 protocols using clone g46 2

1

Generation of HLA-DR Expressing Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell lines expressing single HLA-DR alleles were prepared from K562 cells, which do not express surface class I or II HLA, by lentiviral transduction. Sequences for the DR α-chain and the relevant β-chain alleles (DRB1*01:01 and DRB1*04:04) separated by a 2A peptide sequence were encoded in the N103 lentiviral vector backbone (kindly provided by J. Crabtree, Stanford University) and used to produce lentiviruses in HEK293 cells using previously published methods61 (link). To enhance expression levels of HLA-DR in our K562 cell lines, we selected and expanded the top 1% of cell populations selected on the basis of surface HLA-DR signal with fluorescence-activated cell sorting (clone L243; BD Biosciences 347367) as described before62 (link). Expression of HLA-DR was confirmed by flow cytometry before and after sorting (Supplementary Fig. 6). K562 cells were also monitored for surface HLA-I alleles to ensure no endogenous HLA expression was present (anti-HLA-I antibody; clone G46-2.6; BD Biosciences, 555555; Supplementary Fig. 6). Cells were maintained in DMEM medium (Sigma) supplemented with 2.0 μg ml−1 puromycin (Sigma).
Chen B., Khodadoust M.S., Olsson N., Wagar L.E., Fast E., Liu C.L., Muftuoglu Y., Sworder B.J., Diehn M., Levy R., Davis M.M., Elias J.E., Altman R.B, & Alizadeh A.A. (2019). Predicting HLA class II antigen presentation through integrated deep learning. Nature biotechnology, 37(11), 1332-1343.
+ Open protocol
+ Expand
2

CRISPR-Mediated Generation of MHC-Low Tumor Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Generation of MHCLOW tumor cells was achieved by CRISPR knockout of beta-2-microglobulin (B2M). Briefly, tumor cells were cotransfected with a recombinant TrueCut Cas9 Protein v2 and a TrueGuide Synthetic guide RNA targeting human B2M (ID number, CRISPR983706_SGM targeting the sequence GAGTAGCGCGAGCACAGCTA), by using the Lipofectamine CRISPRMAX transfection reagent. All reagents were purchased from Thermo Fisher Scientific, and assays were performed by following the manufacturer’s recommended protocol. MHC-class ILOW cells were flow sorted by HLA-A/B/C staining (BD, Clone G46–2.6) and expanded for cytotoxic assays.
Fousek K., Horn L.A., Qin H., Dahut M., Iida M., Yacubovich D., Hamilton D.H., Thomas A., Schlom J, & Palena C. (2022). An Interleukin-15 Superagonist Enables Antitumor Efficacy of Natural Killer Cells Against All Molecular Variants of SCLC. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer, 18(3), 350-368.
+ Open protocol
+ Expand
3

Multispecies Leukocyte Antigen Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human leukocyte antigen (HLA) class I (A,B,C) (clone G46–2.6, BD) and HLA class II (DR,DP,DQ) (clone Tu39, BD); swine leukocyte antigen (SLA) class I (clone JM1E3, Bio-Rad, Hercules, CA) and SLA class II (DR, clone 2E9/13; DQ, clone K274.3G8, Bio-Rad).
Hara H., Iwase H., Nguyen H., Miyagawa Y., Kuravi K., Foote J.B., Eyestone W., Phelps C., Ayares D, & Cooper D.K. (2021). Stable expression of the human thrombomodulin transgene in pig endothelial cells is associated with a reduction in the inflammatory response. Cytokine, 148, 155580.
+ Open protocol
+ Expand
4

Phenotypic Analysis of DC Maturation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Phenotypical assessment of DC maturation after 48 h of co-culture with tumor cells was performed by flow cytometry. Briefly, cells were washed in PBA, incubated with Fc-receptor blocking buffer (2% HS in PBS, 15 min at 4°C) and subsequently stained with primary antibodies in PBA (30 min at 4°C). Monoclonal directly labeled anti-human antibodies used were (Table S1): anti-CD11c-APC (Miltenyi biotec, clone MJ4-27G12, catalog# 130-092-412), anti-CD123-APC (Miltenyi biotec, clone AC145, catalog# 130-090-901), anti-CD80-PECy7 (BD PharMingen, clone L307.4, catalog# 561135), anti-CD86-PECy7 (BD PharMingen, clone 2331, catalog# 561128), anti-HLA-ABC-PE (BD PharMingen, clone G46-2.6, catalog# 555553), and anti-HLA-DR-PE (BD PharMingen, clone G46-6, catalog# 555812). Appropriate isotype controls were included. Geometric mean fluorescence intensity (GeoMFI) of maturation markers was assessed on CD11c+ (for CD1c+ and CD16+ DCs) or CD123+ (for pDCs) populations. As a positive control, DCs were stimulated with poly I:C (CD1c+ and CD16+ DCs, 2 µg/mL, Enzo Life Science, catalog# ALX-746-021-M005) or R848 (pDCs, 4 µg/mL, Enzo Life Science, catalog# ALX-420-038-M025). To improve in vitro pDC viability, IL-3 (10 ng/mL, Cellgenix, catalog# 1002-050) was added to culture medium.
Di Blasio S., Wortel I.M., van Bladel D.A., de Vries L.E., Duiveman-de Boer T., Worah K., de Haas N., Buschow S.I., de Vries I.J., Figdor C.G, & Hato S.V. (2016). Human CD1c+ DCs are critical cellular mediators of immune responses induced by immunogenic cell death. Oncoimmunology, 5(8), e1192739.
+ Open protocol
+ Expand
5

CRISPR-Mediated Generation of MHC-Low Tumor Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Generation of MHCLOW tumor cells was achieved by CRISPR knockout of beta-2-microglobulin (B2M). Briefly, tumor cells were cotransfected with a recombinant TrueCut Cas9 Protein v2 and a TrueGuide Synthetic guide RNA targeting human B2M (ID number, CRISPR983706_SGM targeting the sequence GAGTAGCGCGAGCACAGCTA), by using the Lipofectamine CRISPRMAX transfection reagent. All reagents were purchased from Thermo Fisher Scientific, and assays were performed by following the manufacturer’s recommended protocol. MHC-class ILOW cells were flow sorted by HLA-A/B/C staining (BD, Clone G46–2.6) and expanded for cytotoxic assays.
Fousek K., Horn L.A., Qin H., Dahut M., Iida M., Yacubovich D., Hamilton D.H., Thomas A., Schlom J, & Palena C. (2022). An Interleukin-15 Superagonist Enables Antitumor Efficacy of Natural Killer Cells Against All Molecular Variants of SCLC. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer, 18(3), 350-368.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!