A2780 cells were purchased from Sigma-Aldrich Co. (St Louis, MO) and were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS, Gibco). Cells were tested with a Cell Culture Contamination Detection Kit (Thermo Fisher Scientific) and results appeared negative for mycoplasma contamination. Wogonin, with a chemical structure shown in Figure 1(a) , was purchased from Aokebio (Beijing, China). Methylpiperidinopyrazole (MPP) was purchased from Apexbio. The antibodies were from Abcam (Akt, β-actin), Proteintech (caspase-3, cleaved-caspase-3, cyclin D1, CDK4, and CDK6), Santa Cruz Biotechnology (ER-α), and Cell Signaling Technology (Bcl-2, Bax, VEGF, and p53).
A2780 cells
Manufactured by Merck Group
Sourced in United States
A2780 cells are a type of human ovarian cancer cell line commonly used in research. They are derived from an ovarian carcinoma and maintain several characteristics of ovarian cancer cells. A2780 cells are a valuable tool for studying ovarian cancer biology and evaluating potential therapeutic agents.
Automatically generated - may contain errors
Lab products found in correlation
Skov3, by American Type Culture Collection (4 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions)
Skov3 cells, by American Type Culture Collection (3 mentions)
Bcl2 associated x (bax), by Cell Signaling Technology (1 mentions)
Vascular endothelial growth factor (vegf), by Cell Signaling Technology (1 mentions)
Cell culture contamination detection kit, by Thermo Fisher Scientific (1 mentions)
Bcl 2, by Cell Signaling Technology (1 mentions)
Caspase 3, by Santa Cruz Biotechnology (1 mentions)
Cleaved caspase 3, by Santa Cruz Biotechnology (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
L glutamine, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Harvard Bioscience (1 mentions)
Skov3 htb 77, by American Type Culture Collection (1 mentions)
Dmem medium, by Thermo Fisher Scientific (1 mentions)
Penicillin, by Thermo Fisher Scientific (1 mentions)
Dulbecco s modified eagle s medium, by Thermo Fisher Scientific (1 mentions)
Pcdna3, by Takara Bio (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
A2780cr, by Merck Group (1 mentions)
Sizeb2, by GenePharma (1 mentions)
19 protocols using a2780 cells
1
Wogonin's Anti-Cancer Potential Explored
2
Ovarian Cancer Cell Line Cultivation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A2780 cells were purchased from Sigma-Aldrich, Vienna, Austria. Caov-3 (HTB-75), MDAH-2774, OVCAR-3 (HTB-161) and SKOV-3 (HTB-77) cells were purchased from ATCC, Wesel, Germany. B2/92, B16/92, B17/92 and B74/93 cells [47 (link)] were a kind gift of Prof. C. Brumm, Mainz, Germany, and HOC-7 cells [48 (link)] were generously provided by Prof. C. Dittrich, Vienna, Austria. IGROV1 [49 (link)] and SKOV-6 [50 (link)] cells were kindly obtained from Prof. R. Brown, London, UK, and Prof. L. Old, New York City, NY, respectively, and the A2780 variant cell line A2780V [8 (link)] was generously provided by Prof. R. Zeillinger, Vienna, Austria. Cell lines were cultured in the appropriate medium (i.e., RPMI 1640, DMEM high glucose, MEM with Earle's Salts or McCoy's 5A; all from PAA, Pasching, Austria) supplemented with 10% (v/v) FBS (Biochrom, Berlin, Germany), 2 mM L-glutamine and 1x penicillin/streptomycin (both from Gibco, Lofer, Austria). Before exceeding 80% confluency, cells were split in accordance with standard cell culture procedures using a 1x conc. trypsin solution (Gibco) and subcultured at a density of 1×104 cells/cm2.
3
Establishing Galectin-3 Knockout in A2780 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HOMECs (ScienCell Research Laboratories) were cultured in endothelial cell medium (ECM; catalog no. 1001), and ovarian carcinoma A2780 cells (Sigma-Aldrich, catalog no. 93112519) were cultured in RPMI 1640 medium. Each was supplemented with penicillin (100 U ml−1) and streptomycin (100 μg ml−1). Tumor KO-g3 A2780 cells were developed using CRISPR-Cas9 methods and selected on puromycin (1 mM). Single guide RNAs (gRNAs) targeting the exon 3 of galectin-3 were designed for the KO study. The designed guides were screened in silico for off-target activity using the CRISPR search with mismatches, insetions and/or deletions (COSMID) webtool (53 (link)), and the gRNA (CATGATGCGTTATCTGGGTC) with the least number of off targets was selected for the KO experiments. The guide was delivered as a ribonucleoprotein complex with Cas9 to the A2780 cell line using an optimized nucleofection protocol.
4
Synthesis and Characterization of Amphiphilic Triblock Copolymers
5
FOXM1 Expression and Silencing in Ovarian Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SKOV3 cells were obtained from American Type Culture Collection (ATCC) and were cultured in Dulbecco's modified Eagle's medium (Gibco BRL, Gaithersburg, MD). A2780 cells were obtained from Sigma-Aldrich Corporation (St. Louis, MO) and were cultured in RPMI 1640. All cells were cultured with 10% fetal bovine serum (Gibco BRL, Gaithersburg, MD), 100 U/mL penicillin (Invitrogen, Carlsbad, CA), and 100 mg/mL streptomycin, and were incubated at 37°C in 5% CO2 humidified air. Cells were cytogenetically tested and authenticated before being frozen. Transfections were performed with Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA) using 1–2 mg of expression vector/ml serum-free medium as described by the manufacturer. The coding regions of FOXM1 were inserted into pcDNA3.1 (Clontech, Mountain View, CA). A lentiviral vector carrying FOXM1 shRNA was used to silence FOXM1 in A2780 and SKOV3 cells, and stable clones were generated by puromycin selection.
6
Ovarian Cancer Cell Line Comparison
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ovarian cancer cells A2780 cells and their cisplatin-resistant derivatives (referred in this study as A2780-CR) were obtained from Sigma (St Louis, MO, United States) while SK-OV-3 cells were from ATCC (Manassas, VA, United States). Cells were cultured in RPMI 1640 media with 10% fetal bovine serum and 1% antibiotics in a 5% CO2-humidified atmosphere at 37°C. The si-HOTTIP as well as si-ZEB2 was purchased from Shanghai GenePharma Co., Ltd. (China).
7
Culturing Ovarian Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ovarian cancer cells SK-OV-3 were purchased from ATCC (Manassas, USA) and the A2780 cells, along with their cisplatin-resistant derivative cells (A2780Cis) were purchased from Sigma (St Louis, USA). All cells were cultured in RPMI 1640 media, with the presence of 10% fetal bovine serum, in 5% CO2–humidified atmosphere at 37 °C.
8
Establishment of Cisplatin-Resistant Ovarian Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ES2 cells were purchased from ATCC (Manassas, USA) and cultured in McCoy’s 5a medium with 10% FBS in 5% CO2–humidified incubators at 37°C. siRNA against c-myb was purchased from SCBT (USA). Cisplatin resistant ES2 cells were generated in the laboratory by long term exposure (over four months) of the cells to cisplatin with gradual increase of cisplatin concentration after every 4-5 passages (Supplementary Figure S1 ). Parental and cisplatin resistant A2780 cells were purchased from Sigma (St Louis, USA) and cultured in RPMI 1640 media with 10% FBS in 5% CO2–humidified incubators at 37°C. For the routine maintenance and propagation, cisplatin resistant cells were cultured with sub-IC-50 concentrations of cisplatin in the culture media and the cisplatin resistance of these cells was periodically confirmed by evaluating the IC-50 values.
9
Ovarian Carcinoma Cell Lines and Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cisplatin-sensitive and -resistant human ovarian carcinoma A2780 cells were purchased from Sigma-Aldrich; Merck KGaA). Paclitaxel-sensitive and -resistant (PR) human ovarian carcinoma SKOV3 cells were obtained from the MD Anderson Cancer Center (Houston, TX, USA). Cells were incubated at 37°C in a humidified atmosphere of 5% CO2 and cultured in Dulbecco's modified Eagle's medium containing 10% heat-inactivated fetal bovine serum (both, Gibco; Thermo Fisher Scientific, Inc.), streptomycin (100 mg/ml), and penicillin (100 U/ml).
10
Cell Line Authentication and Maintenance
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!