Chromo4 four color real time pcr detection system
The Chromo4 Four-Color Real-Time PCR Detection System is a laboratory instrument designed for real-time polymerase chain reaction (PCR) analysis. It is capable of detecting up to four different fluorescent dyes simultaneously during the PCR process.
Lab products found in correlation
4 protocols using chromo4 four color real time pcr detection system
Quantitative Real-Time PCR Analysis
RNA Isolation and Transcription for Chondrocytes
Quantitative Real-Time PCR Assay for Gene Expression
Osteogenic Differentiation of BMSCs
Primer sequences used in RT-PCR and qPCR
Target gene | GenBank accession no. | Sequences (5’–3’) |
---|---|---|
GAPDH | NM_017008.4 | Forward, CAGGGCTGCCTTCTCTTGTG |
RUNX2 | NM_001145920.2 | Forward, AATTAACGCCAGTCGGAGCA |
OSX | NM_001037632.1 | Forward, GCCTACTTACCCGTCTGACTTT |
OCN | NM_001037939.2 | Forward, TCTATGACCTGCAGAGGGCT |
Col1α1 | NM_000088.3 | Forward, AGTGGTTTGGATGGTGCCAA |
β-catenin | XM_006511927.1 | Forward, CTGCAACGACCTGACTGGTA |
GSK-3β | XM_006522425.1 | Forward, AGAAGAGCCATCATGTCGGG |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!