BV173 cells were infected with human CSRP2 shRNA lentiviral particles (Santa Cruz Biotechnology, Santa Cruz, CA) or blank control lentiviral particles (Santa Cruz) at a 100 multiplicity of infection (MOI). Media containing lentiviral particles were replaced with complete medium 12 h post-infection and stably transfected BV173 cells were selected with 0.5 μg/ml puromycin dihydrochloride (Genechem, Shanghai, China) at 96 h post-infection. Ramos cells were infected with human CSRP2 lentiviral activation particles (Santa Cruz) or control lentiviral activation particles (Santa Cruz) at a 100 MOI. Stably transfected Ramos cells were selected with 2.5 μg/ml puromycin dihydrochloride (Genechem), 15 μg/ml Blasticidin S HCl™ (Solarbio, Beijing, China) and 2000 μg/ml Hygromycin B™ (Solarbio). CSRP2 expression levels were confirmed by RT-qPCR and western blot analyses.
Hygromycin b
Manufactured by Solarbio
Sourced in China
Hygromycin B is a broad-spectrum antibiotic used as a selective agent in molecular biology applications. It inhibits protein synthesis in both prokaryotic and eukaryotic cells, making it effective for selection of recombinant cells and organisms.
Automatically generated - may contain errors
Lab products found in correlation
Puromycin, by Solarbio (2 mentions)
Puromycin dihydrochloride, by Genechem (1 mentions)
Control lentiviral activation particles, by Santa Cruz Biotechnology (1 mentions)
Warfarin, by Merck Group (1 mentions)
Probenecid, by Merck Group (1 mentions)
Poly d lysine, by Merck Group (1 mentions)
Bca protein assay kit, by CWBIO (1 mentions)
Trypsin, by Thermo Fisher Scientific (1 mentions)
Furosemide, by Merck Group (1 mentions)
Dichloromethane, by J&K Scientific (1 mentions)
Methanol, by J&K Scientific (1 mentions)
N hexane, by J&K Scientific (1 mentions)
Akta protein purification system, by GE Healthcare (1 mentions)
Superdex 200 increase 5 150 gl column, by GE Healthcare (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Gen elute plasmid miniprep, by Merck Group (1 mentions)
Streptavidin pe, by BioLegend (1 mentions)
Turbofect transfection reagent, by Thermo Fisher Scientific (1 mentions)
Restriction endonuclease, by Thermo Fisher Scientific (1 mentions)
Oligonucleotide, by Sangon (1 mentions)
15 protocols using hygromycin b
1
Lentiviral Transduction of CSRP2 in BV173 and Ramos Cells
2
RFP-Pb2 Transgenic Plant Root Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The seeds of PPb2::RFP-Pb2 transgenic plants (T0) and Suyunuo (WT) were soaked in water for two days and germinated at 27 °C for one day, and then healthy seeds were selected and planted in 0.3% agar gel (Solarbio, Cat#A8190) containing 50 μg/mL hygromycin B (Solarbio, Cat#H8080). After culturing for 4 days in an artificial climate box (dark at 27 °C), plants with normal root growth were selected and the roots were rinsed with ddH2O. The 2–3 mm root tip was chosen to make slices, and the fluorescence value was observed under a laser confocal microscope (Leica SP8, Heidelberg, Germany). The excitation wavelength was 580 nm and the emission wavelength was 610 nm. In order to avoid false fluorescence signals due to autofluorescence, first, 5–7 samples with WT as the control were observed, and then the fusion RFP material was observed after confirming that there was no autofluorescence.
3
Cellular Uptake Assay of Fluorescent Probe
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Probenecid, furosemide, warfarin and poly-D-Lysine were purchased from Sigma-Aldrich Chemical Co. (St. Louis, MO, USA). 6-Carboxyfluorescein (6-CF) was obtained from Aladdin (Shanghai, China). Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS) and trypsin were purchased from Gibco (Gaithersburg, MD, USA). Hygromycin B was purchased from Solarbio (Beijing, China). BCA protein assay kit was purchased from Cwbio (Beijing, China). Methanol, n-hexane, dichloromethane, and n-butanol were purchased from J&K Chemical (Beijing, China). All other chemicals, unless indicated, were purchased from Sigma-Aldrich Co. (St. Louis, MO, USA).
4
Fusarium oxysporum Protoplast Preparation and Transformation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
F. oxysporum protoplast preparation and fungal transformation were performed as previously described (Li et al., 2019a (link)). The split-marker PCR approach was used to generate targeted gene replacement vectors (Catlett et al., 2003 (link); Fang et al., 2018 (link); Yang et al., 2018 (link)). Primers used for amplifying flanking sequences for each gene are listed in Supplementary Table S2 . These primers were used to amply fragments for transformation using PCR, after which the PCR products were purified and transformed into protoplasts of wild type strain Fol4287. Hygromycin B (Solarbio, Beijing, China) was added to agar medium at a final concentration of 300 μg ml–1 for transformant selection. The putative targeted gene deletion mutants were screened by PCR assays with two pairs of primers in Supplementary Table S2 and further confirmed by Southern blots.
5
Genetic Manipulation of Botrytis cinerea
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Escherichia coli DH5α and Agrobacterium tumefaciens EHA105 were used to construct vectors and transform plasmid DNA. E. coli and A. tumefaciens strains were grown on Luria-Bertani (LB) media. The plasmid pBHt2 enables the selection of hygromycin-resistant (hph) transformants. The ABA-producing strain B. cinerea TB-31 was transformed with pBHt2 to create insertional mutants by ATMT (Rolland et al., 2003 (link)). B. cinerea TB-31 was used as a control for this study to generate gene knockout and complementary mutants of bcfrp1. B. cinerea strains grow on potato glucose agar (PDA) media at 26°C for 7 days, followed by the collection of spores and resuspended to 1 × 106 conidia·mL−1. The PDA plates with 50 μg·mL−1 hygromycin B or 100 μg·mL−1 glufosinate-ammonium, were purchased from Solar Biotech, to screen the B. cinerea transformants.
6
Purification of ADAMTS13 variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
WT- and GOF-ADAMTS13 were expressed in HEK293T cells with lipofectamine 3000. Plasmid and liposome volume ratio was 1:1.5. HEK293T cell complete medium was DMEM medium with 10% FBS. The transfected cells was incubated for 2 days in 5% CO2 at 37°C, then screened with 1% hygromycin B (Solarbio Science & Technology, Beijing, CN). Stably transfected cell lines were obtained after about 20 days, and expanded to collect 500 ml of culture medium for purification. The proteins of interest were eluted with different concentrations of imidazole using an AKTA protein purification system (GE Healthcare) in conjunction with a Ni2+-Hi-Trap-chelating column (GE Healthcare). Gel filtration chromatography was performed to further purify the proteins with the Superdex™ 200 Increase 5/150 GL column (GE Healthcare). Purified proteins were verified by 7.5% SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) and Western blot. Protein concentration was measured with BCA kit according to the manufacturer’s instructions.
7
Lentiviral Modulation of Ror2 and Stat3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The recombinant lentivirus vector downregulation of mouse Ror2 gene and overexpression of mouse Stat3 gene were generated by Cyagen Biosciences, Inc. (Guangzhou, China) and iGeneBio Biotechnology (Guangzhou, China), respectively.
According to the manufacturer’s instructions, mBMSCs were infected with lentivirus-based shRNA vector downregulation of Ror2 (sh-Ror2) and lentivirus-based shRNA vector overexpression of Stat3 (sh-Stat3). Briefly, mBMSCs were plated at 1.5 × 104 cells/cm2 in 12-well plates overnight and then infected with lentivirus in the presence of 5 μg/mL polybrene (iGeneBio Biotechnology, Guangzhou, China) for 8 h. After 72 h, mBMSCs infected with sh-Ror2 were selected with 1 μg/mL puromycin (Solarbio, Beijing, China). Those mBMSCs infected with sh-Ror2 and sh-Stat3 were selected with 1 μg/mL puromycin and 50 μg/mL hygromycin B (Solarbio, Beijing, China). The expression of Ror2 and Stat3 was assessed by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot analysis.
According to the manufacturer’s instructions, mBMSCs were infected with lentivirus-based shRNA vector downregulation of Ror2 (sh-Ror2) and lentivirus-based shRNA vector overexpression of Stat3 (sh-Stat3). Briefly, mBMSCs were plated at 1.5 × 104 cells/cm2 in 12-well plates overnight and then infected with lentivirus in the presence of 5 μg/mL polybrene (iGeneBio Biotechnology, Guangzhou, China) for 8 h. After 72 h, mBMSCs infected with sh-Ror2 were selected with 1 μg/mL puromycin (Solarbio, Beijing, China). Those mBMSCs infected with sh-Ror2 and sh-Stat3 were selected with 1 μg/mL puromycin and 50 μg/mL hygromycin B (Solarbio, Beijing, China). The expression of Ror2 and Stat3 was assessed by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot analysis.
8
Engineered HER2 and HER3 Expression in NIH3T3 and MCF7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pCMV3-HER2 cDNA and pCMV3-HER3 cDNA plasmids were purchased from Sino Biological. The HER2 929C_T point mutation (from the first ATG of HER2 cDNA) was constructed by polymerase chain reaction (PCR) with primers 1 and 2 and confirmed by DNA sequencing. HER3 cDNA gene was amplified from the pCMV3-HER3 plasmid, and EcoRI and NotI restriction enzyme sites were added at both ends with primers 3 and 4. Then, the full-length sequence was inserted into the pMH3 expression vector. All primers are listed in Table S1
NIH3T3 cells were co-transfected with the wild-type (WT)/S310F-mutant HER2 and HER3 constructs using Lipofectamine 3000 according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA). MCF7 cells were transfected with the WT/S310F-mutant HER2 construct using the above method. For stable ectopic expression, stable WT/S310F-mutant HER2-expressing NIH3T3 cells were selected with Hygromycin B (Solarbio, China) and G418 (Sangon Biotech, China). Stable WT/S310F-mutant HER2-expressing MCF7 cells were selected with Hygromycin B.
NIH3T3 cells were co-transfected with the wild-type (WT)/S310F-mutant HER2 and HER3 constructs using Lipofectamine 3000 according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA). MCF7 cells were transfected with the WT/S310F-mutant HER2 construct using the above method. For stable ectopic expression, stable WT/S310F-mutant HER2-expressing NIH3T3 cells were selected with Hygromycin B (Solarbio, China) and G418 (Sangon Biotech, China). Stable WT/S310F-mutant HER2-expressing MCF7 cells were selected with Hygromycin B.
9
Establishing ASPH-Overexpressing HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pcDNA3.1-ASPH
constructs were first transformed into Top 10 F′ strain (Novagen)
as a propagation host using the calcium chloride transformation method
to make a reserve of the construct. After harvesting GenElute Plasmid
Miniprep (Sigma), the plasmids were linearized utilizing FspI (New England Biolabs) according to the manufacturer’s instructions.
Then, a stable human cervical carcinoma cell line (HeLa) with overexpression
of ASPH on the cell surface (HeLaASPH) was established
using linearized pcDNA3.1/Hygro(+)-ASPH plasmid and TurboFect Transfection
Reagent (Thermo Fisher Scientific) according to the manufacturer’s
instructions, followed by a selection using 200 mg/mL hygromycin B
(Solarbio Science & Technology). Transfection was evaluated by
measuring mRNA (Forward primer: TTGGCGTGGGATACCTCTTG; Reverse primer:
GTCACACTCAGCACCTCTTC) using quantitative RT-PCR and the 2–ΔΔCt method.31 (link) Also, the flow
cytometry analysis of cell surface-displayed ASPH was performed using
FB-50 biotinylated antibody and PE-streptavidin (BioLegend).
constructs were first transformed into Top 10 F′ strain (Novagen)
as a propagation host using the calcium chloride transformation method
to make a reserve of the construct. After harvesting GenElute Plasmid
Miniprep (Sigma), the plasmids were linearized utilizing FspI (New England Biolabs) according to the manufacturer’s instructions.
Then, a stable human cervical carcinoma cell line (HeLa) with overexpression
of ASPH on the cell surface (HeLaASPH) was established
using linearized pcDNA3.1/Hygro(+)-ASPH plasmid and TurboFect Transfection
Reagent (Thermo Fisher Scientific) according to the manufacturer’s
instructions, followed by a selection using 200 mg/mL hygromycin B
(Solarbio Science & Technology). Transfection was evaluated by
measuring mRNA (Forward primer: TTGGCGTGGGATACCTCTTG; Reverse primer:
GTCACACTCAGCACCTCTTC) using quantitative RT-PCR and the 2–ΔΔCt method.31 (link) Also, the flow
cytometry analysis of cell surface-displayed ASPH was performed using
FB-50 biotinylated antibody and PE-streptavidin (BioLegend).
10
Molecular Cloning Reagents Specification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chemicals were obtained from Sigma, Merck or Ameresco. Oligonucleotides were synthesized by Shanghai Sangon Biotech Co. Ltd (China). Taq and pfu DNA polymerases, RevertAid Reverse Transcriptase, restriction endonucleases were purchased from Fermentas or New England BioLabs. The kits used for molecular cloning were bought from Omega Bio-tek Biotechnology. Difco™Potato Dextrose Agar was from BD. Trizol was from Invitrogen Life Technologies Corporation. DIG High Prime DNA Labelling and Detection Starter Kit I was purchased from RocheApplied Science. Hygromycin B was obtained from Solarbio Science Technology Co., Ltd (China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!