Cleanamp dntps

Like all poxviruses, CaPV genomes contain a stretch of nucleotides, called functional resolution sequence (FRS), that is situated between the telomeres and the first tandem repeat (Merchlinsky, 1990 (link)). This highly conserved sequence was used to amplify and sequence the 5′ and 3′ termini of the CaPV genome with primer pair: FRS TTTTATAGGCTTAAAAAAAAGTATAATATTG and ORF1 ATTTTAGCAAGAGCAGCAGAATATTGG. The PCR reaction was set up as follows (final concentrations): 1x Q5 High-Fidelity DNA Polymerase reaction buffer (New England Biolabs), 1 M betaine, 0.5 μM of both FRS and ORF1 primers, 0.4 mM CleanAmp dNTPs (TriLink Biotechnologies), 1 U of Q5 High-Fidelity DNA polymerase, 5 μL of DNA template, and distilled water up to a volume of 50 μL. Cycling conditions were as follows: 98 °C for 3 min (initial denaturation), 35 cycles of 10 s at 98 °C, 30 s at 63 °C and 1 min at 72 °C (amplification), followed by 2 min at 72 °C (final elongation).
Discrepancies between the full-length consensus sequences and previously published vaccine-associated Neethling genomes (n = 7; accession numbers: AF409138, MN636838−43) were confirmed or refuted by dideoxy chain terminator sequencing (Sanger sequencing). Sequencing was performed on an Applied Biosystems 3130 Genetic Analyzer Sequencer using the BrightDye Terminator Cycle Sequencing kit (Nimagen) according to the manufacturer’s instructions.

LR-PCR reactions were set up as follows (all mentioned concentrations are final concentrations): 1x Q5 High-Fidelity DNA Polymerase reaction buffer (New England Biolabs), 1 M betaine, 0.5 μM of both forward (pf) and reverse (pr) primer, 0.4 mM CleanAmp dNTPs (TriLink Biotechnologies), 1 U of Q5 High-Fidelity DNA polymerase, 5 μL of DNA template, and distilled water up to a volume of 50 μL. Cycling conditions were as follows: 98 °C for 3 min (initial denaturation), 35 cycles of 10 s at 98 °C, 30 s at 63 °C and 7 min at 72 °C (amplification), followed by 2 min at 72 °C (final elongation). The PCR products were stained with Midori Green Direct (Nippon Genetics) before being visualized on 1% agarose gels. Only single products of the expected size were purified using the Agencourt AMPure XP system (Beckman Coulter) according to the manufacturer’s instructions. Purified DNA was quantified on a Quantus Fluorometer (Promega) using the QuantiFluor dsDNA System (Promega).

In order to achieve uniform coverage of the entire genome, an enrichment step was performed prior to sequencing using an in-house long-range PCR that covered the entire genome with 23 overlapping amplicons of approximately 7.5 kb in length [43 (link)]. Briefly, PCRs were performed in a mix containing 1 M betaine, 0.5 μM of both forward and reverse primers, 0.4 mM CleanAmp dNTPs (TriLink Biotechnologies, San Diego, CA, USA) and 1 U of Q5 High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA). Cycling conditions were as follows: 98 °C for 3 min, 35 cycles of 10 s at 98 °C, 30 s at 63 °C and 7 min at 72 °C, followed by 2 min at 72 °C. Each amplicon was individually visualised by gel electrophoresis and purified using the Agencourt AMPure XP system (Beckman Coulter, Brea, CA, USA). The purified DNA was quantified and equimolarly pooled.