Log In Sign up
The largest database of trusted experimental protocols

Anti zeb1 antibody

Manufactured by Santa Cruz Biotechnology
Visit Supplier
Sourced in United States

The Anti-ZEB1 antibody is a research tool designed for the detection and study of the ZEB1 protein. ZEB1 is a transcription factor that plays a role in the epithelial-mesenchymal transition (EMT) process. This antibody can be used in various techniques, such as Western blotting, immunohistochemistry, and immunofluorescence, to analyze the expression and localization of the ZEB1 protein in biological samples.

Automatically generated - may contain errors

Lab products found in correlation

Mock igg control, by Santa Cruz Biotechnology (2 mentions) Nuclear extraction kit, by Thermo Fisher Scientific (1 mentions) Tris hcl gel, by Bio-Rad (1 mentions) Anti snail antibody, by Abcam (1 mentions) Radioimmunoprecipitation assay buffer, by Thermo Fisher Scientific (1 mentions) Anti β actin antibody, by Merck Group (1 mentions) Anti hdac1 antibody, by Santa Cruz Biotechnology (1 mentions) Anti cytokeratin 19 antibody, by Santa Cruz Biotechnology (1 mentions) Anti histone h3, by Cell Signaling Technology (1 mentions) Polyvinylidene difluoride membrane, by Bio-Rad (1 mentions) Normal rabbit igg, by Cell Signaling Technology (1 mentions) Polyclonal anti β actin antibody, by Merck Group (1 mentions) Anti vimentin monoclonal antibody, by Agilent Technologies (1 mentions) Ecl western blotting detection system, by GE Healthcare (1 mentions) Bradford protein assay, by Bio-Rad (1 mentions) Anti β actin antibody, by Santa Cruz Biotechnology (1 mentions) Anti β actin, by Merck Group (1 mentions) Full length e cadherin, by OriGene (1 mentions) Anti myc, by Merck Group (1 mentions) Anti flag, by Merck Group (1 mentions)

8 protocols using anti zeb1 antibody

1

Chromatin Immunoprecipitation to Analyze ZEB1 Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chromatin immunoprecipitation assays were performed as previously described (32 (link), 35 (link)). Immunoprecipitation was carried out using an anti-ZEB1 antibody or mock IgG control (Santa Cruz, Dallas, TX). Promoter segment enrichment was analyzed by qPCR using primers (Supplementary methods) flanking the potential ZEB1 binding sites along the LOXL2 promoter.
Peng D.H., Ungewiss C., Tong P., Byers L.A., Wang J., Canales J.R., Villalobos P.A., Uraoka N., Mino B., Behrens C., Wistuba I.I., Han R.I., Wanna C.A., Fahrenholtz M., Grande-Allen K.J., Creighton C.J, & Gibbons D.L. (2016). ZEB1 Induces LOXL2-Mediated Collagen Stabilization and Deposition in the Extracellular Matrix to Drive Lung Cancer Invasion and Metastasis. Oncogene, 36(14), 1925-1938.
+ Open protocol
+ Expand
2

Zeb1-Mediated Ovol2 Promoter Regulation

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was performed with an anti-Zeb1 antibody (Santa Cruz) according to the previously described protocol [11 (link)]. The following primers were used to detect Ovol2 promoter regions: proximal site (forward, 5’-GTGATAGGGGTATGAAGCAGAGG-3’ reverse, 5’-CACCAGGAAACTTGGGAGTG-3’) and distal site (forward, 5’-AGCCCAGAAATCCGTTACCA-3’ reverse, 5’-CTCACTGCTGGAGGTTGTCT-3’).
Hong T., Watanabe K., Ta C.H., Villarreal-Ponce A., Nie Q, & Dai X. (2015). An Ovol2-Zeb1 Mutual Inhibitory Circuit Governs Bidirectional and Multi-step Transition between Epithelial and Mesenchymal States. PLoS Computational Biology, 11(11), e1004569.
+ Open protocol
+ Expand
3

Quantitative Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blotting was performed as described previously.24 Briefly, total protein was extracted from PDAC cell lines in radioimmunoprecipitation assay buffer (Thermo Fisher Scientific, Rockford, IL, USA) and nuclear proteins were extracted with the Nuclear Extraction Kit according to the manufacturers’ protocol. Aliquots of total protein (12 μg) were electrophoresed on sodium dodecyl sulfate polyacrylamide gels, 10% Tris‐HCL gels (Bio‐Rad Laboratories, Hercules, CA, USA). The separated proteins were transferred to polyvinylidene difluoride membranes (Bio‐Rad Laboratories) and incubated with primary antibodies for 1 hour. Proteins were detected with anti‐HDAC1 antibody (1:200 dilution; Santa Cruz Biotechnology), anti‐SNAIL antibody (1:2000 dilution; Abcam), anti‐ZEB1 antibody (1:1000 dilution; Santa Cruz Biotechnology), anti‐Cytokeratin 19 antibody (1:200 dilution; Santa Cruz Biotechnology), anti‐Histone H3 (1:2000; Cell Signaling Technology, Danvers, MA, USA) and anti–β‐actin antibody (diluted 1:4000; Sigma, Tokyo, Japan). The expression relative to actin expression was depicted as a column and measured with ImageJ software (rsb.info.nih.gov/ij).
Shinke G., Yamada D., Eguchi H., Iwagami Y., Asaoka T., Noda T., Wada H., Kawamoto K., Gotoh K., Kobayashi S., Takeda Y., Tanemura M., Mori M, & Doki Y. (2018). Role of histone deacetylase 1 in distant metastasis of pancreatic ductal cancer. Cancer Science, 109(8), 2520-2531.
+ Open protocol
+ Expand
4

ChIP-qPCR Analysis of ZEB1 Binding

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was performed as previously described [29 (link)]. Briefly, cells were fixed for 15-minutes in RMPI-1640 media containing 10% FBS and 1% Formaldehyde, and fixation quenched through addition of Glycine (final concentration 0.125M). Fixed cells were lysed and chromatin sheared to a size of 100–500 bp. ChIP was performed using 5µg of an anti-ZEB1 antibody (Santa Cruz, Cat# sc-25388X). As a negative control, normal rabbit IgG (Cell Signaling Technology, Cat# 2729S) was used. Input samples were generated by taking the supernatant of the normal rabbit IgG immunoprecipitation. Input and ChIP samples were subjected to qPCR in sextuplet using primers against an E-box near the transcriptional start site of BCL2L11 (Forward: cgggaggctagggtaca, Reverse: caggctcggacaggtaaag), or against an E-box near the 5’-end of Exon 2 of BCL2L11 (Forward: ctaaccccgggaagtcagag, Reverse: agggtacccccaaacaaaat).
Song K.A., Niederst M.J., Lochmann T.L., Hata A.N., Kitai H., Ham J., Floros K.V., Hicks M.A., Hu H., Mulvey H.E., Drier Y., Heisey D.A., Hughes M.T., Patel N.U., Lockerman E.L., Garcia A., Gillepsie S., Archibald H.L., Gomez-Caraballo M., Nulton T.J., Windle B.E., Piotrowska Z., Sahingur S.E., Taylor S.M., Dozmorov M., Sequist L.V., Bernstein B., Ebi H., Engelman J.A, & Faber A.C. (2017). Epithelial-to-mesenchymal transition antagonizes response to targeted therapies in lung cancer by suppressing BIM. Clinical cancer research : an official journal of the American Association for Cancer Research, 24(1), 197-208.
+ Open protocol
+ Expand
5

Chromatin Immunoprecipitation to Analyze ZEB1 Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chromatin immunoprecipitation assays were performed as previously described (32 (link), 35 (link)). Immunoprecipitation was carried out using an anti-ZEB1 antibody or mock IgG control (Santa Cruz, Dallas, TX). Promoter segment enrichment was analyzed by qPCR using primers (Supplementary methods) flanking the potential ZEB1 binding sites along the LOXL2 promoter.
Peng D.H., Ungewiss C., Tong P., Byers L.A., Wang J., Canales J.R., Villalobos P.A., Uraoka N., Mino B., Behrens C., Wistuba I.I., Han R.I., Wanna C.A., Fahrenholtz M., Grande-Allen K.J., Creighton C.J, & Gibbons D.L. (2016). ZEB1 Induces LOXL2-Mediated Collagen Stabilization and Deposition in the Extracellular Matrix to Drive Lung Cancer Invasion and Metastasis. Oncogene, 36(14), 1925-1938.
+ Open protocol
+ Expand
6

Immunoblotting of Epithelial-Mesenchymal Transition Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sample protein concentrations were measured by the Bradford protein assay (Bio-Rad), and 20 μg total protein/lane was subjected to electrophoresis on 10% polyacrylamide gels followed by electroblotting onto nitrocellulose filters. The membranes were blocked with 3% milk in TBS-T and incubated overnight at 4°C with the following antibodies: anti-NUAK1 polyclonal antibody (Cell Signaling Technology, #4458), anti-E-cadherin monoclonal antibody (BD Transduction Laboratories, 610181), anti-N-cadherin monoclonal antibody (BD Transduction Laboratories, 610920), anti-SNAI1 polyclonal antibody (Cell Signaling Technology, #3879), anti-SNAI2 polyclonal antibody (Cell Signaling Technology, #9585), anti-ZEB1 antibody (Santa Cruz Biotechnology, sc-25388), anti-vimentin monoclonal antibody (Dako, #M0725), and anti-β-actin polyclonal antibody (Sigma-Aldrich, A5441). The membranes were then washed with TBS-T and incubated with specific secondary antibodies, and the proteins were visualized using the ECL western blotting detection system (GE Healthcare).
Obayashi M., Yoshida M., Tsunematsu T., Ogawa I., Sasahira T., Kuniyasu H., Imoto I., Abiko Y., Xu D., Fukunaga S., Tahara H., Kudo Y., Nagao T, & Takata T. (2016). microRNA-203 suppresses invasion and epithelial-mesenchymal transition induction via targeting NUAK1 in head and neck cancer. Oncotarget, 7(7), 8223-8239.
+ Open protocol
+ Expand
7

Western Blot Analysis of ZEB1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
EOC cells were harvested 72 h after transient transfection and western blot analysis was performed to detect the expression levels of ZEB1 protein. Cells were lysed using RIPA buffer (50 mM Tris-HCl, pH 8.8, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS). The proteins were resolved on an SDS denaturing polyacrylamide gel and then transferred onto a nitrocellulose membrane. Filters were blocked in PBS-Tween skim milk and probed with anti-ZEB1 antibody (dilution 1∶1000, Santa Cruz Biotechnology, Santa Cruz, USA) or probed with anti-β-actin antibody (Santa Cruz Biotechnology, Santa Cruz, USA). β-actin was used as an internal control for the normalization of candidate genes. The membranes were washed and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies. Protein expression was assessed by enhanced chemiluminescence and exposure to chemiluminescent film (Pierce Biotechnology).
Jin M., Yang Z., Ye W., Xu H, & Hua X. (2014). MicroRNA-150 Predicts a Favorable Prognosis in Patients with Epithelial Ovarian Cancer, and Inhibits Cell Invasion and Metastasis by Suppressing Transcriptional Repressor ZEB1. PLoS ONE, 9(8), e103965.
+ Open protocol
+ Expand
8

Immunoblotting of Epithelial-Mesenchymal Transition Markers

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The mouse monoclonal anti-myc, anti-FLAG, anti-GFP, and anti-B-actin antibodies were obtained from Sigma (St. Louis, MO), while the anti-E-cadherin and anti-vimentin antibodies were purchased from BD Biosciences (San Diego, CA). The mouse polyclonal anti-TLE1 antibody was obtained from Abcam (Cambridge, MA) while the anti-Zeb1 antibody was purchased from Santa Cruz Biotechnology, Santa Cruz, CA). The FLAG-AES and the various plasmid constructs encoding for Bit1 were generated as described previously [9 (link)]. The GFP-TLE1 and the full length E-cadherin encoding plasmids were obtained from Origene (Rockville, MD).
Yao X., Pham T., Temple B., Gray S., Cannon C., Chen R., Abdel-Mageed A.B, & Biliran H. (2016). The Anoikis Effector Bit1 Inhibits EMT through Attenuation of TLE1-Mediated Repression of E-Cadherin in Lung Cancer Cells. PLoS ONE, 11(9), e0163228.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!