The 409B2 human iPS cell line37 (link) was cultured in complete Essential 8 medium (A1517001, Thermo Fisher Scientific) on culture dishes coated with iMatrix-511™ (892011, Wako). For NSC-induction, iPS colonies were dispersed to single cells with TrypLE Express™ (12605-028, Thermo Fisher Scientific) and then centrifuged. Cells were re-suspended in PSC-Neural induction medium™ (1647801, Thermo Fisher Scientific) and cultured on Matrigel™(354234, Corning, NY, USA)-coated dishes for 1 week. NSC differentiation was confirmed by differentiation to NESTIN-positive and NF-M positive neural cells.
Imatrix 511
Manufactured by Fujifilm
Sourced in Japan
The IMatrix-511 is a lab equipment product manufactured by Fujifilm. It is designed to perform core functions necessary for laboratory operations. The product specifications and technical details are available upon request.
Automatically generated - may contain errors
Lab products found in correlation
Matrigel, by Corning (2 mentions)
Stemfit ak02n medium, by Ajinomoto (2 mentions)
Tryple express, by Thermo Fisher Scientific (1 mentions)
Psc neural induction medium, by Thermo Fisher Scientific (1 mentions)
Complete essential 8 medium, by Thermo Fisher Scientific (1 mentions)
Y 27632, by Nacalai Tesque (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Rbc2lcn fitc, by Fujifilm (1 mentions)
Penicillin streptomycin p s, by Thermo Fisher Scientific (1 mentions)
Kf 4109, by Kurabo (1 mentions)
Dulbecco modified eagle medium (dmem), by Nacalai Tesque (1 mentions)
Stemfit ak02n, by Ajinomoto (1 mentions)
Fibroblast growth factor 2 (fgf2), by Thermo Fisher Scientific (1 mentions)
Bone morphogenetic protein 4 (bmp4), by Thermo Fisher Scientific (1 mentions)
2 mercaptoethanol, by Merck Group (1 mentions)
Dmem f12 medium, by Fujifilm (1 mentions)
Tgf β3, by R&D Systems (1 mentions)
Penicillin, by Nacalai Tesque (1 mentions)
Streptomycin, by Nacalai Tesque (1 mentions)
Tgf β inhibitor sb 431542, by Bio-Techne (1 mentions)
5 protocols using imatrix 511
1
Differentiation of Human iPSCs to NSCs
2
Human iPSC Culture in StemFit AK02 N
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human iPSCs (201B7; Takahashi et al., 2007 (link)) were maintained in StemFit AK02 N medium (Ajinomoto). Cells were seeded at a density of 1.5 × 104 cells/well in an iMatrix 511 (Laminin511E8; Wako)-treated six-well plate; 10 μm Y27632 (Nacalai) was only added for the first day. Culture media were changed every other day.
3
hiPSC and hSkMC Culture Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
201B7 cells2 (link) were provided by RIKEN BRC through the Project for Realization of Regenerative Medicine and the National Bio-Resource Project of the MEXT, Japan. 201B7 cells and ehiPSC (A18945, Thermo Fisher scientific, USA) were maintained in Stemfit AK02N (Ajinomoto, Japan) in 25 cm2 cell culture flask (690–175; Greiner Bio-One, Austria) coated with 0.5 µg/cm2 laminin-511 E8 (iMatrix-511, 381–07363; Wako, Japan). The undifferentiated state of the hiPSCs was confirmed using rBC2LCN-FITC (Wako, Japan). hFBS (KF-4109; Kurabo, Japan) were cultivated in a 75 cm2 cell culture flask containing Dulbecco’s modified Eagle’s medium (DMEM; 08458–16, Nacalai Tesque, Japan) supplemented with 10% fetal bovine serum (FBS; Life Technologies, USA) and 1% penicillin-streptomycin (PS; Life Technologies). hSkMCs (CC-2561, Lonza, Switzerland) were cultivated in a 25 cm2 cell culture flask containing Skeletal Muscle Cell GM (C-39360, Promo Cell, Germany). iCMs (RCDC001N, ReproCell, Japan) were cultured according to the manufacturer’s instructions.
4
Feeder-free Maintenance of Human Pluripotent Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In on-feeder cultures, cells were maintained on mitomycin C-treated mouse embryonic fibroblasts (MEF) with DMEM/F12 medium (Wako) containing 20% KnockOut serum replacement (KSR; Thermo Fisher Scientific), 0.1 mM non-essential amino acids (NEAA; Nacalai), 0.1 mM 2-mercaptoethanol (Sigma), 4 ng/mL FGF2 (PeproTech), 100 U/mL penicillin (Nacalai), and 100 μg/mL streptomycin (Nacalai) in an atmosphere containing 3% CO2. Feeder-free PSCs were maintained on iMatrix 511 (Laminin511 × 108; Wako) with StemFit AK02 N medium (Ajinomoto), or on Matrigel (Corning) with mTeSR1 medium (Stemcell Technologies) under 5% CO2 condition. For small-scale screening, the following reagents were added to the maintenance medium for 2 days before the organoid generation: 100 nM FGFR inhibitor PD173074 (Cayman), 5 μM Wnt inhibitor IWR1e (Sigma), 5 μM TGFβ inhibitor SB431542 (Tocris), 150 nM BMP inhibitor LDN193189 (StemRD), 1 μM Shh agonist SAG (Cayman), 100 ng/mL BMP4 (PeproTech), 10 ng/mL ActivinA (Nacalai), 1 ng/mL TGFβ3 (R&D). Human PSC experiments were performed in accordance with the guidelines with approval from the Ministry of Education, Culture, Sports, Science, and Technology (MEXT) of Japan and the Keio University School of Medicine Ethics Committee.
5
CRISPR/Cas9-mediated Deletion of ISL1 in hESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
hESCs were maintained using iMatrix511 (Matrixome) and Stem fit (AK03N, Ajinomoto, Japan) feeder free culture (Nakagawa et al., 2014 ). The Cas9 and puromycin-resistance gene bearing plasmid pSpCas9(BB)-2A-Puro (Addgene), with a pair of CRISPR/Cas9 guide RNAs designed so as to delete the first and second exons of the ISL1 gene (Sequence ID: CCAACTCCGCCGGCTTAAAT, GGGAGGTTAATACTTCGGAG), was transfected to the hESCs by electroporation (Nucleofector IIb, program B-016, Lonza). Transfected hESCs were cultured in a six-well plate (1.0 × 103 cells per well; AGC Techno Glass, Japan) coated with iMatrix511 in the presence of 10 μM Y-27632 (ROCK inhibitor, Wako Pure Chemical Industries, Japan) in Stem fit. One day after inoculation, the medium was replaced without Y-27632. Thereafter, the hESCs were cultured for six days in the presence of 0.5 ng/mL puromycin for puromycin selection. The successfully transfected colonies were picked up and the genomic DNA was analyzed using PCR primers designed around the target site. We then established two clones with ISL1 gene deletion (No. 330A16 line and No. 330A19 line). ISL1 gene-deleted hESC clones were analyzed by Sanger sequencing to confirm disruption of the ISL1 gene.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!