Real time detection system

The gene expression of Cox-2 was measured by Real Time RT-PCR method [19 (link)–21 (link)]. Briefly, total RNA was extracted from rat tissue using the PureLink RNA kit (Invitrogen, USA). RNA quantity and purity were determined using NanoDrop microspectrophotometer ND-1000 (Wilmington, DE). One μg of total RNA was reverse-transcribed to high capacity cDNA using a reverse transcription kit including mixture of random primers (Applied Biosystems, Foster City, CA). Real time quantitative RT-PCR analysis was carried out by SYBR Green I dye detection (Applied Biosystems, Foster City, CA) using the real time detection system (Bio-Rad). Real-time PCR primers were designed with PrimerExpress software was as follows:
Primers were synthesized in DNA Sequencing and Oligonucleotide Synthesis Laboratory IBB, PAS (Poland). Optimized conditions were as follows: 1 min at 48 °C, 7 min, and 30 s at 95 °C and 45 cycles of 20 s at 95 °C and 35 s at 62 °C in which an optical acquirement were performed. Melt curves were performed upon completion of the cycles to ensure absence of nonspecific products. Quantification was performed by normalizing cycle threshold (Ct) values with the Cox2 control gene 18s, and analysis was carried out with the 2−ΔΔCT method [9 (link)].

HepG2 or other cell lines stably shRNA or fusion protein were cultured in 3.5 cm dishes. At 85% confluence, cells were harvested, and total RNA was extracted from the cells using an Axygen RNA extraction kit. After quantification, 0.25 μg of the total RNA was used for cDNA synthesis within 20 μL reaction mixtures according to the protocol provided by a reverse transcription kit (Thermo Fisher Scientific). When the reaction finished, the resulting products were diluted to 100 μL with ddH₂O. For one qPCR reaction, 1 μL of cDNA samples was mixed with 0.5 μL of 5 μM forward and reverse primers and 10 μL of 2×SYBRGreen PCR Mastermix within a 20 μL reaction system. qPCR reactions were performed in a Bio-Rad real-time detection system as described previously (Zhang et al., 2022 (link)). An Actin gene was used as a reference gene, and GAPDH gene expression acted as a negative control when qPCR data were processed. The sequences of all primers used in qPCR were presented in Supplementary file 1.

One thousand of mouse embryonic stem cells were seeded in 12-well plate and cultured in feeder-free condition. When the cells grew for 10 days, cell colonies were used for alkaline phosphatase staining. Briefly, cell colonies were fixed by 4% of formaldehyde that was prepared with 1*PBS buffer. When fixation finished, the cell colonies were washed for 3 times with 1*PBS buffer and stained for 1 hour with BCIP and NBT staining solution (Sangon, Biotech). The samples were washed for twice with 1*PBS buffer after staining and dried for photography. To perform RT-qPCR, the total RNA was prepared from mouse embryo stem cells and mouse embryonic fibroblast cells with RNA miniprep kit (Axygene). cDNA were synthesized with 0.5 μg of total RNA using 1 U of reverse transcriptase (Thermo). Quantitative PCR was performed with SYBR Green reaction mixture (Thermo) and Bio-Rad real time detection system. The qPCR data were analyzed by Bio-Rad CFX Manager 3.1 software. Relative gene expression was obtained by comparing the gene expression in stem cells with that in MEF, in which the gene expression in MEF was arbitrarily set as 1.

Total RNA from mouse aortas was isolated using the Bullet Blender Homogenizer (Next Advance, Averill Park, NY, USA) in TRIzol reagent (Invitrogen) according to the manufacturer's protocol. Total RNA from BMDMs was isolated using TRIzol reagent. One microgram of total RNA was reverse‐transcribed using the iScript RT Supermix (Bio‐Rad, Hercules, CA, USA), following the manufacturer's protocol. Quantitative real‐time PCR was performed in triplicate using iQ SYBR green Supermix (Bio‐Rad) on a Real‐Time Detection System (Bio‐Rad). The mRNA level was normalized to ribosomal RNA 18S as a housekeeping gene. The following mouse primer sequences were used: CD68, 5′‐CCAATTCAGGGTGGAAGAAA‐3′ and 5′‐CTCGGGCTCTGATGTAGGTC‐3′; IL‐6, 5′‐AGTTGCCTTCTTGGGACTGA‐3′ and 5′‐TCCACGATTTCCCAGAGAAC‐3′; TNF‐α, 5′‐CCCTCACACTCAGATCATCTTCT‐3′ and 5′‐GCTACGACGTGGGCTACAG‐3′; IL‐1β, 5′‐CCAAAATACCTGTGGCCTTGG‐3′ and 5′‐GCTTGTGCTCTGCTTGTGAG‐3′; MerTK, 5′‐TGCGTTTAATCACACCATTGGA‐3′ and 5′‐TGCCCCGAGCAATTCTTTC‐3′; 18S, 5′‐TTCCGATAACGAACGAGACTCT‐3′ and 5′‐TGGCTGAACGCCACTTGTC‐3′.
Mature miR‐21 levels were detected using TaqMan miRNA Assay kit (Life Technologies) according to the manufacturer's protocol. Quantitative real‐time PCR was performed using TaqMan Universal Master Mix (Life Technologies; Chamorro‐Jorganes et al, 2011, 2014; Suarez et al, 2007, 2008, 2010). RNA U6 was used for normalization.

Total RNA was isolated from mouse primary macrophages and aortas using RNAiso Plus (TaKaRa, D9108A) according to the manufacturer's protocol. RNA quantity and purity were assessed using Nanodrop 1000 spectrophotometer (Thermo Scientific), confirming 260/280 ratio of 1.8 to 2.1 for all samples. 1 μg of total RNA was used for reverse transcription using the ReverTra Ace^® qPCR RT Master Mix with gDNA Remover (TOYOBO, FSQ‐301). The primers (Table S1) were used. Quantitative real‐time PCR was performed using Applied Biosystems^™ SYBR^™ Green (Thermo Scientific^™) on a Real‐Time Detection System (BioRad). The mRNA level was normalized to β‐actin.

Total cellular RNA was isolated from HUVECs and HEK293 cells using the Total RNA Kit I (#R683401) purchased from Omega Bio-Tek (Norcross, GA). The cDNA was synthesized using the iScriptTM cDNA Synthesis Kit (170–8891, Bio-Rad). The resulting cDNA was subjected to quantitative polymerase chain reaction (PCR) using the iQTM SYBR Green Supermix (170–8880). The Real Time Detection System was obtained from Bio-Rad (Hercules, CA). SIRT1 primer (Forward: 5′-GCAGGTTGCGGGAATCCAA-3′ and reverse: 5′-GGCAAGATGCTGTTGCAAA-3′) and 18 s primer (Forward: 5′-TGCTGCAGTTAAAAAGCTCGT-3′ and reverse: 5′-GGCCTGCTTTGAACACTCTAA-3′) were synthesized by Sigma (St. Louis, MO).