Abi prism 7500 machine

Total RNA was extracted using an RNA extraction kit (Accurate Biology, AG21023) and then reverse transcribed using RT Master Mix for qPCR (MCE, HY-K0510). Real-time qPCR was carried out in a 20-μl system using the SYBR Green qPCR Master Mix (MCE, HY-K0501) and ABI Prism 7500 machine (Applied Biosystems, CA, USA). β-Actin was used as the internal control, and the results were calculated using the ΔΔC_t method. The following gene-specific primers were used for RT-qPCR: IL-2, F-5′TGAGCAGGATGGAGAATTACAGG and R-GTCCAAGTTCATCTTCTAGGCAC3′; IL-4, F-5′GGTCTCAACCCCCAGCTAGT and R-GCCGATGATCTCTCTCAAGTGAT3′; Tlrr4, F-5′ATGGCATGGCTTACACCACC and R-GAGGCCAATTTTGTCTCCACA3′; and Runx1, F-5′GATGGCACTCTGGTCACCG and R-GCCGCTCGGAAAAGGACAA3′.

The expression levels of the osteogenic markers osteopontin (OPN) and osteocalcin (OCN) were detected by real-time reverse transcription-polymerase chain reaction (real-time RT-PCR). Briefly, after 21 d of culturing the cells on each control or test sample, RNA from the cells was extracted with TRIzol (Invitrogen). Total RNA was reverse transcribed to complementary DNA (cDNA) using a high-capacity RNA-to-cDNA kit (Applied Biosystems, Carlsbad, CA, USA). For DNA amplification, solutions with specific primers and SYBR green (Applied Biosystems) were added to the respective cDNA samples. Real-time PCR was then performed using an ABI Prism 7500 machine (Applied Biosystems). The expression level of each osteogenic gene was normalized against the amount of glyceraldehyde 3-phosphate dehydrogenase. To confirm the findings, immunofluorescence staining was performed with solutions of anti-OPN antibody (Santa Cruz Biotechnology, Dallas, TX, USA) and anti-OCN antibody (QED Bioscience, San Diego, CA, USA) in blocking solution (1% BSA in PBS) at 4 °C for 1 d. After the cells were rinsed with wash buffer, they were soaked in solution with goat anti-mouse lgG-FITC (Santa Cruz Biotechnology, Dallas, TX, USA) for 1 h. The stained cells were observed using CLSM (LSM700, Carl-Zeiss).

Total mRNA from the hepatoblastoma primary tissues and cell lines was extracted using the Trizol regent (Invitrogen), as per the manufacturer's protocols. The total mRNA was reversed transcribed into cDNA using the PrimeScript RT reagent kit (Takara, Dalian, P.R China). Meanwhile, microRNAs were reverse transcribed into cDNA using a miRNA-specific loop RT primer (Ribobio, Guangzhou, China). Amplification of target genes (SNHG9, Wnt3a c-MYC, β-catenin and miR23a-5p) was carried out using SYBR Premix Ex Taq II (Takara Biotechnology, China) on a ABI Prism 7500 machine (Applied Biosystems, Thermo scientific). GAPDH and U6 were used as as endogenous controls for mRNAs and miRNA respectively. The relative fold changes in mRNA/miRNAs expression were calculated by the 2^-∆∆CT method. The primers sequence for distinct of the target genes and miRNAs used in this study are enlisted in Supplementary File 1.

Total RNA was extracted using Easy Blue^® reagent (Intron Biotechnology, Gyeonggi-do, South Korea) and following the chloroform/isopropanol purification procedure. cDNA synthesis was performed with 1 μg total RNA using Moloney murine leukemia virus reverse transcriptase (M-MVL RT) (Promega, Madison, WI, USA) and random primers according to the manufacturer’s instructions. For real-time PCR analysis, endogenous mRNA levels were measured based on SYBR Green (Applied Biosystems, Foster City, CA, USA) detection with an ABI Prism 7500 machine (Applied Biosystems). Results were normalized with the β-actin expression. The real-time PCR primers used are shown in Table S1.

A commercial real time M. hyopneumoniae PCR (rt-PCR) was performed in laryngeal swabs, BALF and lung tissue samples. The assay was performed using VetMAX™-Plus qPCR Master Mix (Applied Biosystems, USA) and VetMAX™ M. hyopneumoniae Reagents (Applied Biosystems, USA), according to the manufacturer’s instructions. VetMAX™-Plus qPCR Master Mix kit includes Xeno™ DNA Control, which serves as an internal positive control for DNA purification and rt-PCR. Runs were carried out in an ABIPRISM^® 7500 machine (Applied Biosystems, Singapore). The threshold for the DNA target was set at 10% of the average maximum fluorescence value of the positive control DNA target. Cycle threshold (Ct) values equal to or lower than 40 were considered positive.

Brain cerebral cortices and hippocampi were isolated on ice and flash-frozen in liquid nitrogen. RNA was extracted using Chomczynski method with TRI-reagent according to manufacturer’s protocols (Sigma-Aldrich/Merck). DNA was digested with DNase I (Sigma-Aldrich). The concentration and purity of RNA were assessed spectrophotometrically (A₂₆₀/A₂₈₀ method). Reverse transcription of 4 μg of total RNA was performed with avian myeloblastosis virus (AMV) reverse transcriptase and random primers (High Capacity Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA). Real-time PCR was performed with TaqMan Gene Expression Assay kits using ABI PRISM 7500 machine (both reagents and equipment—Applied Biosystems). Each sample was analyzed in tri- to quadruplicate. Gene expression was calculated using the ddCt method and normalized against actin B (ACTB).