Tianscript reverse transcription kit

Some genes identified in the transcriptome sequencing analysis were further validated and quantified by real-time PCR (qRT-PCR). The primer sequences (Table S2) were designed with Primer Premier 5 according to the transcriptome sequencing data. The total RNA was extracted from the same samples using a Thermo Scientific GeneJET RNA Purification kit (#K0731), as in the Illumina sequencing step. After DNase-mediated DNA degradation, the RNA concentration was determined and 2 μg of total RNA was reverse transcribed in a 20-μl reaction volume using the TIANScript reverse transcription Kit (Tiangen).
qRT-PCR was performed in a LightCycler R480 Real-time Detection System (Roche). The reaction was carried out in a 20-μl reaction volume using the FastStart Universal SYBR Green Master (ROX) according to the manufacturer’s protocol. A melting curve analysis of the amplification products at the end of each reaction was performed to confirm the specificity of amplification. To quantify the transcription of each gene, the copy number was determined by generating a standard curve using a serial 10-fold dilution of the targeted PCR product inserted into the pMD^TM 19-T vector (TaKaRa Bio Group). For sample normalization, 18S rRNA was used as an internal standard. All of the reactions were performed in triplicate, and the data were normalized using the average for the internal standard.

Trizol (Invitrogen), chloroform, isopropanol and ethanol were successively used to extract the total RNA from the EECs. RNA concentration was assessed using a NanoDrop spectrophotometer (Thermo Scientific, Waltham, MA). For each sample, 1 μg of total RNA was used to synthesize cDNA with a TIANscript reverse transcription kit (TIANGEN Biotech, Beijing, China) according to the manufacturer’s instructions. Real-time RT-PCR was performed in triplicate for each sample using SYBR Premix Ex Taq II (TaKaRa Biotech, Dalian, China) according to the manufacturer’s instructions. Reactions were carried out using a Roche LightCycler480. Amplification of beta-actin was used for normalization. The primers used in this assay were as follows: OPN: sense 5’- ACAGCCGTGGGAAGGACAGTTA -3’, antisense, 5’- CCTGACTATCAATCACATCGGAATG -3’; MMP-9: sense, 5’-AGTCCACCCTTGTGCTCTTCCC -3’, antisense, 5’-TCTGCCACCCGAGTGTAACCAT-3’; beta-actin: sense, 5’-AGCGAGCATCCCCCAAAGTT-3’, antisense, 5’-GGGCACGAAGGCTCATCATT-3’. The relative expression levels of each gene were determined with the 2^−ΔΔCt method [24 (link)].

Total RNA was extracted from HCT-116 and IMCE cells and tumor-adjacent tissues utilizing the RNeasy mini kit (Qiagen, Carlsbad, CA, USA) and conversely transcribed using the TIANScript reverse transcription kit (TIANGEN Inc. Beijing, China), respectively. Real-time PCR was conducted to quantify the production of cytokines such as IL-6, IL-1β, TNF-α, and MUC2. Relevant oligonucleotide primer sequences were shown in Table 2. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), known as a housekeeping gene, was used as inner control to normalize the relative expression of targeted genes at mRNA level. Real-time PCR was performed using a StepOnePlus real-time PCR instrument (Applied Biosystems, Carlsbad, CA) following the manufacturer's directions. All cDNA products were assessed in triplicate. Expression of each transcript was quantified using the standard ∆∆CT method to calculate the fold changes normalized to corresponding internal controls. The procedure of PCR was constituted of 30 cycles followed by a period of 5 min at 72°C for final extension. Within each cycle, the time period and temperature were 94°C for 30s, 60°C for 30s, and 72°C for 90s, respectively. Relative expression of the genes was calculated using the 2^-ΔΔCT method.